Activin A Receptor Type IB(ACVR1B) (NM_004302) Human Untagged Clone

CAT#: SC108895

ACVR1B (untagged)-Human activin A receptor, type IB (ACVR1B), transcript variant 1

USD 196


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Activin A Receptor Type IB(ACVR1B) (NM_004302) Human Untagged Clone
Symbol ACVR1B
Synonyms ACTRIB; ACVRLK4; ALK4; SKR2
Vector pCMV6-XL4
Sequence Data
Fully Sequenced ORF
>OriGene ORF sequence for NM_004302 edited
ATGGCGGAGTCGGCCGGAGCCTCCTCCTTCTTCCCCCTTGTTGTCCTCCTGCTCGCCGGC
AGCGGCGGGTCCGGGCCCCGGGGGGTCCAGGCTCTGCTGTGTGCGTGCACCAGCTGCCTC
CAGGCCAACTACACGTGTGAGACAGATGGGGCCTGCATGGTTTCCATTTTCAATCTGGAT
GGGATGGAGCACCATGTGCGCACCTGCATCCCCAAAGTGGAGCTGGTCCCTGCCGGGAAG
CCCTTCTACTGCCTGAGCTCGGAGGACCTGCGCAACACCCACTGCTGCTACACTGACTAC
TGCAACAGGATCGACTTGAGGGTGCCCAGTGGTCACCTCAAGGAGCCTGAGCACCCGTCC
ATGTGGGGCCCGGTGGAGCTGGTAGGCATCATCGCCGGCCCGGTGTTCCTCCTGTTCCTC
ATCATCATCATTGTTTTCCTTGTCATTAACTATCATCAGCGTGTCTATCACAACCGCCAG
AGACTGGACATGGAAGATCCCTCATGTGAGATGTGTCTCTCCAAAGACAAGACGCTCCAG
GATCTTGTCTACGATCTCTCCACCTCAGGGTCTGGCTCAGGGTTACCCCTCTTTGTCCAG
CGCACAGTGGCCCGAACCATCGTTTTACAAGAGATTATTGGCAAGGGTCGGTTTGGGGAA
GTATGGCGGGGCCGCTGGAGGGGTGGTGATGTGGCTGTGAAAATATTCTCTTCTCGTGAA
GAACGGTCTTGGTTCAGGGAAGCAGAGATATACCAGACGGTCATGCTGCGCCATGAAAAC
ATCCTTGGATTTATTGCTGCTGACAATAAAGATAATGGCACCTGGACACAGCTGTGGCTT
GTTTCTGACTATCATGAGCACGGGTCCCTGTTTGATTATCTGAACCGGTACACAGTGACA
ATTGAGGGGATGATTAAGCTGGCCTTGTCTGCTGCTAGTGGGCTGGCACACCTGCACATG
GAGATCGTGGGCACCCAAGGGAAGCCTGGAATTGCTCATCGAGACTTAAAGTCAAAGAAC
ATTCTGGTGAAGAAAAATGGCATGTGTGCCATAGCAGACCTGGGCCTGGCTGTCCGTCAT
GATGCAGTCACTGACACCATTGACATTGCCCCGAATCAGAGGGTGGGGACCAAACGATAC
ATGGCCCCTGAAGTACTTGATGAAACCATTAATATGAAACACTTTGACTCCTTTAAATGT
GCTGATATTTATGCCCTCGGGCTTGTATATTGGGAGATTGCTCGAAGATGCAATTCTGGA
GGAGTCCATGAAGAATATCAGCTGCCATATTACGACTTAGTGCCCTCTGACCCTTCCATT
GAGGAAATGCGAAAGGTTGTATGTGATCAGAAGCTGCGTCCCAACATCCCCAACTGGTGG
CAGAGTTATGAGGCACTGCGGGTGATGGGGAAGATGATGCGAGAGTGTTGGTATGCCAAC
GGCGCAGCCCGCCTGACGGCCCTGCGCATCAAGAAGACCCTCTCCCAGCTCAGCGTGCAG
GAAGACGTGAAGATCTAA
5' Read Nucleotide Sequence
>OriGene 5' read for NM_004302 unedited
AAAGCCTTCGCACGAGGCTGGGCTGCGTTCGGCGGCGGCGGCGGTGGTTACTATGGCGGA
GTCGGCCGGAGCCTCCTCCTTCTTCCCCCTTGTTGTCCTCCTGCTCGCCGGCAGCGGCGG
GTCCGGGCCCCGGGGGGTCCAGGCTCTGCTGTGTGCGTGCACCAGCTGCCTCCAGGTCAA
TACACGTGTGAGACAGATGGGGCCTGCATGGTTTCCATTTTCAATCTGGATGGGATGGAG
CACCATGTGCGCACCTGCATCCCCAAAGTGGAGCTGGTCCCTGCCGGGAAGCCCTTCTAC
TGCCTGAGCTCGGAGGACCTGCGCAACACCCACTGCTGCTACACTGACTACTGCAACAGG
ATCGACTTGAGGGTGCCCAGTGGTCACCTCAAGGAGCCTGAGCACCCGATCCATGTGGGG
CCCGGTGGAGCTGGTAGGCATCATCGCCGGCCCGGTGTTCCTCCTGTTCCTCATCATCAT
CATTGTTTTCCTTGTCATTAACTATCATCAGCGTGTCTATCACAACCGCCAGAGACTGGA
CATGGAAGATCCCTCATGTGAGATGTGTCTCTCCAAAGACAAGACGCTCCAGGATCTTGT
CTACGATCTCTCCACCTTCAGGTCTGGCTCAGGGTTACCCCTCTTTGTCCAGCGCACAGT
GGCCCGAACCATCGTTTTTACAAGAAATATTGGCAAGGGTCCGGTTTGGGGAAGTATGGG
CGGGCCCGCTGGAGGGGTGGGTGATGTGGCTGTGAAAATATTCTCTTCCCGGGAAAAACG
GGCTTGGTTCAGGGAAACAGAAATATCCCAAACGGTCATGCTTGGCCATGAAAACACCTT
GGAATTATGGTGCTGCAATTAAAAAAAGGCCCCTGAAACAAATGGGGGTTGTTTTGAACT
TAT
3' Read Nucleotide Sequence
>OriGene 3' read for NM_004302 unedited
TAGGACGCGGCCGCATTCTANGATCGAGTTTTTTTTTTTTTTTTTTAGGGATTTCTTTAA
AAACAAATAGATTGAGAGGTAATCACAGAGATGGTTTTCCTTTTACAAAAACTTAATATT
TAACAACATTAAAAAAAGTTAAAATCCAAACCCTCCCAATAAAATTAAAAAAAGAAATCA
AACCACTCCAGTTAAAAGTTATGGCTTCAAAGTTATTATATACCTAAGATATGCTGACCA
AATCACCACCCACAGCCGTGCTTCTAGGCTTCGTTAAATACTATACTCAGGTTAAATAAC
ATGTTCGGCTCAGGCTGTTCCCTTCAGTAGGGCTCCTGAAGTGGATGCAAACCTCTCACC
TTCCCTCCACCCTGATCAGACAGTCCAGTAAAAGAAGACCCATGCAGATGCCTCCCTCCC
ACCCCAGACTCCCTCCCCACTCCTTGCCCGCCCTTCCCTTCCCCACCCCAAACCCACCAC
CACCAAAAATATACACTGCTGTTTCCAGGATCTGGGAGATGAAAGACAGATGTAACATTC
CAATCTGAGTCCCGAGATCTGGCTTCACATTCCTCGGCCCTTCCTCGATGCTGCTGAGGA
TGATGCCCTTGGGCTGGCTCATTTCCCACGGCTGACACTAACACCCAAGACTTCCACCAG
GATTCCTTCCCTGCCCATCCCACCCACCACCCTCACATTTTTGGCCCAAAAGCCTCTTTT
GTCATGGACAACTGGGCCAGCTTTGGTTCCACAGTCTGAGATGGANGANGAGAGCTGTGC
TGATGCTGGGGTGGGGCAGAGTAGCCTGCCAGACACAGAGTACCACTGTGGCATGAGGGG
CTCTGGGGGAGGGAGAGACCNCAGGGAAGGCACCAGGGAACTAGATGCTGCTCCTACTGA
AAAGAGGCACCGCAGCACGGACGCATGACGACCACCCCCGACCTGCACATGCACAGAAGC
TCAGCAGGTAAGTGCGCACT
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_004302
ORF Size 1518 bp
Insert Size 3300
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_004302.3, NP_004293
RefSeq Size 4540
RefSeq ORF 1518
Locus ID 91
Cytogenetics 12q13.13
Domains Activin_recp, pkinase, TyrKc, S_TKc, GS
Protein Families Protein Kinase, Transmembrane, Druggable Genome
Protein Pathways MAPK signaling pathway, Cytokine-cytokine receptor interaction, Endocytosis, TGF-beta signaling pathway, Adherens junction, Pathways in cancer, Colorectal cancer, Pancreatic cancer, Chronic myeloid leukemia
Gene Summary This gene encodes an activin A type IB receptor. Activins are dimeric growth and differentiation factors which belong to the transforming growth factor-beta (TGF-beta) superfamily of structurally related signaling proteins. Activins signal through a heteromeric complex of receptor serine kinases which include at least two type I and two type II receptors. This protein is a type I receptor which is essential for signaling. Mutations in this gene are associated with pituitary tumors. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Jun 2010]
Transcript Variant: This variant (1) encodes isoform (a).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.