ACOX1 (NM_007292) Human Untagged Clone

CAT#: SC108887

ACOX1 (untagged)-Human acyl-CoA oxidase 1, palmitoyl (ACOX1), transcript variant 2

USD 1,051


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name ACOX1 (NM_007292) Human Untagged Clone
Symbol ACOX1
Synonyms ACOX; PALMCOX; SCOX
Vector pCMV6-XL4
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_007292, the custom clone sequence may differ by one or more nucleotides


ATGAACCCGGACCTGCGCAGGGAGCGGGATTCCGCCAGCTTCAACCCGGAGCTGCTTACACACATCCTGG
ACGGCAGCCCCGAGAAAACCCGGCGCCGCCGAGAGATCGAGAACATGATCCTGAACGACCCAGACTTCCA
GCATGAGGACTTGAACTTCCTCACTCGCAGCCAGCGTTATGAGGTGGCTGTCAGGAAAAGTGCCATCATG
GTGAAGAAGATGAGGGAGTTTGGCATCGCTGACCCTGATGAAATTATGTGGTTTAAAAAACTACATTTGG
TCAATTTTGTGGAACCTGTGGGCCTCAATTACTCCATGTTTATTCCTACCTTGCTGAATCAGGGCACCAC
TGCTCAGAAAGAGAAATGGCTGCTTTCATCCAAAGGACTCCAGATAATTGGCACCTACGCCCAGACGGAA
ATGGGCCACGGAACTCACCTTCGAGGCTTGGAAACCACAGCCACGTATGACCCTGAAACCCAGGAGTTCA
TTCTCAACAGTCCTACTGTGACCTCCATTAAATGGTGGCCTGGTGGGCTTGGAAAGACTTCAAATCATGC
AATAGTTCTTGCCCAGCTCATCACTAAGGGGAAATGCTATGGATTACATGCCTTTATCGTACCTATTCGT
GAAATCGGGACCCATAAGCCTTTGCCAGGAATTACCGTTGGTGACATCGGCCCCAAATTTGGTTATGATG
AGATAGACAATGGCTACCTCAAAATGGACAACCATCGTATTCCCAGAGAAAACATGCTGATGAAGTATGC
CCAGGTGAAGCCTGATGGCACATACGTGAAACCGCTGAGTAACAAGCTGACTTACGGGACCATGGTGTTT
GTCAGGTCCTTCCTTGTGGGAGAAGCTGCTCGGGCTCTGTCTAAGGCGTGCACCATTGCCATCCGATACA
GCGCTGTGAGGCACCAGTCTGAAATCAAGCCAGGTGAACCAGAACCACAGATTTTGGATTTTCAAACCCA
GCAGTATAAACTCTTTCCACTCCTGGCCACTGCCTATGCCTTCCAGTTTGTGGGCGCATACATGAAGGAG
ACCTATCACCGGATTAACGAAGGCATTGGTCAAGGGGACCTGAGTGAACTGCCTGAGCTTCATGCCCTCA
CCGCTGGACTGAAGGCTTTCACCTCCTGGACTGCAAACACTGGCATTGAAGCATGTCGGATGGCTTGTGG
TGGGCATGGCTATTCTCATTGCAGTGGTCTTCCAAATATTTATGTCAATTTCACCCCAAGCTGTACCTTT
GAGGGAGAAAACACTGTCATGATGCTCCAGACGGCTAGGTTCCTGATGAAAAGTTATGATCAGGTGCACT
CAGGAAAGTTGGTGTGTGGCATGGTGTCCTATTTGAACGACCTGCCCAGTCAGCGCATCCAGCCACAGCA
GGTAGCAGTCTGGCCAACCATGGTGGATATCAACAGCCCCGAAAGCCTAACCGAAGCATATAAACTCCGT
GCAGCCAGATTAGTAGAAATTGCTGCAAAAAACCTTCAAAAAGAAGTGATTCACAGAAAAAGCAAGGAGG
TAGCTTGGAACCTAACTTCTGTTGACCTTGTTCGAGCAAGTGAGGCACATTGCCACTATGTGGTAGTTAA
GCTCTTTTCAGAAAAACTCCTCAAAATTCAAGATAAAGCCATTCAAGCTGTCTTAAGGAGTTTATGTCTG
CTGTATTCTCTGTATGGAATCAGTCAGAACGCGGGGGATTTCCTTCAGGGGAGCATCATGACAGAGCCTC
AGATTACACAAGTAAACCAGCGTGTAAAGGAGTTACTCACTCTGATTCGCTCAGATGCTGTTGCTTTGGT
TGATGCATTTGATTTTCAGGATGTGACACTTGGCTCTGTGCTTGGCCGCTATGATGGGAATGTGTATGAA
AACTTGTTTGAGTGGGCTAAGAACTCCCCACTGAACAAAGCAGAGGTCCACGAATCTTACAAGCACCTGA
AGTCACTGCAGTCCAAGCTCTGA


5' Read Nucleotide Sequence
>OriGene 5' read for NM_007292 unedited
GAATTCGGCACGAGGACGCCCAGCAGGGCAATTTCTTGACCTTCGGAGCCCCTTTCCCGA
GGATCCGCTCGGGAGCCTCCCCTGGCCAGGAGCAGGGGATTAGTCTGCCCCGCGACCGGC
CCCAGCCACGACGCGGACATCGCCCCCTCTGTCTGGGCCGCTGTCACTCACGCGTCAAAG
GGCCACGGAGAAAGAAGGGGCGGGCCGGGGCGGGCCGGGCGAGCGGAGGCGGGGACTTGC
GCCGTCCTGAGGCTGCCTCCTAGGGTCCGGCCGGCGCTGGAGCTGCGGATTTAGATTGTC
ACTGCCACCTCGGTCGGTGCTTACTTCGCTGCCAGCTGGTCGTCGCCATGAACCCGGACC
TGCGCAGGGAGCGGGATTCCGCCAGCTTCAACCCGGAGCTGCTTACACACATCCTGGACG
GCAGCCCCGAGAAAACCCGGCGCCGCCGAGAGATCGAGAACATGATCCTGAACGACCCAG
ACTTCCAGCATGAGGACTTGAACTTCCTCACTCGCAGCCAGCGTTATGAGGTGGCTGTCA
GGAAAAGTGCCATCATGGTGAAGAAGATGAGGGAGTTTGGCATCGCTGACCCTGATGAAA
TTATGTGGTTTAAAAATTTTGTGCACCGAGGGCGGNCTGAGCCTCTGGATCTTCACTTGG
GCATNGTCCTGCCCACCTTGCTTCACCANGCAACTGCNGAGCAGCAGGAGCGCTTCTTCA
TGCCCGCCTGGAACTTGGNAGATCATTGGCACTTATGCC
3' Read Nucleotide Sequence
>OriGene 3' read for NM_007292 unedited
TGCTTTGGACCGGCGGCCGCAATCTAGGGTCGAGTTTTTTTTTTTTTTTTTTTTTTTTTT
TTTTTTTTTTTGACTTTAAAAAAAAATAATTAAGATGTATTTAACCTTTAAGTATAGAAT
GATTGGATAAATTAGATTTCAACTGAAAGGACAATTAGCGATTCAGAGAAAGCTCCTAAA
AATAGACTGAAAACAAAGCCCTACATAGAGTAAGAAATAGAACCTATGGAACTTCCATTT
TTCTAACTATAGTTTTTTGGTTTTGGTTTTTCCCAGTTGTTAAAAAAAAAACAACTCACA
GTTTCAATATTTTCTGAACCAAAAATCAGAACACATGGTTTGGGTCAAAGGGTTTTTCTG
GGCTACGTCTGGGAGGGCTGACCTAAGGGACATTTTTTTTTAATGCCAAATACAGTAATC
TCCAAGCTTTTAATGGCTTATGCCAAGATGACAGAATATGTGAAATCTGATTGTCCCAAA
GTTACACTCTGCACTCCAAAGCTACAACAGTGCCACAGCTGAGAGGGTTCCCTATACTTC
CTACTACTGGGACAATTTAGCGATCCTTCAAATGGAAAATTCCTAATTACACGAGACAAT
GGTCCTACAGTAGGCCCGTGCGGAATAAGTTCCCTCGTTGGAAAAATGCTAGCATGAATA
GTTTGATAAATGCCATCCATCAGCAAAGGAGAGCAAGCAGGCAGAGACTGTGCCAAGCAG
AAACTCATTCGCATCAGGTTTCCAATAAGTTTCCTTTCCCCAGCCCCTTTTTTTAATCCT
GCTTTAAGCCCAGCCCCAGGGTAAGTCTGTGAAACACTGAGCAGAAAGCTTGGAAGGTTC
TAACACATTTAAAATACCCTTGCTAAAACACTTAATAGCCCGGGATAGCAATTAAATGGG
AAATATCACCCCTCCGGGGTTAAATTCTGCTATATCAAAGGCATACCTACTGGAACAN
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_007292
ORF Size 1983 bp
Insert Size 3420
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_007292.3, NP_009223
RefSeq Size 3445
RefSeq ORF 1983
Locus ID 51
Cytogenetics 17q25.1
Protein Families Druggable Genome
Protein Pathways Fatty acid metabolism, alpha-Linolenic acid metabolism, Biosynthesis of unsaturated fatty acids, Metabolic pathways, PPAR signaling pathway
Gene Summary The protein encoded by this gene is the first enzyme of the fatty acid beta-oxidation pathway, which catalyzes the desaturation of acyl-CoAs to 2-trans-enoyl-CoAs. It donates electrons directly to molecular oxygen, thereby producing hydrogen peroxide. Defects in this gene result in pseudoneonatal adrenoleukodystrophy, a disease that is characterized by accumulation of very long chain fatty acids. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008].
Transcript Variant: This variant (2) has multiple differences in the coding region but maintains the reading frame, compared to variant 1. The encoded isoform (b, alternately known as ACOX1a per PMID: 17603022), is the same length as isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.