GGT1 (NM_005265) Human Untagged Clone

CAT#: SC108766

GGT1 (untagged)-Human gamma-glutamyltransferase 1 (GGT1), transcript variant 1

USD 196.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name GGT1 (NM_005265) Human Untagged Clone
Symbol GGT1
Synonyms CD224; D22S672; D22S732; GGT; GGT 1; GTG
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC108766 sequence for NM_005265 edited (data generated by NextGen Sequencing)
ATGAAGAAGAAGTTAGTGGTGCTGGGCCTGCTGGCCGTGGTCCTGGTGCTGGTCATTGTC
GGCCTCTGTCTCTGGCTGCCCTCAGCCTCCAAGGAACCTGACAACCATGTGTACACCAGG
GNNNNCGTGGCCGCGGATGCCAAGCAGTGCTCGAAGATTGGGAGGGATGCACTGCGGGAC
GGTGGCTCTGCGGTGGATGCAGCCATTGCAGCCCTGTTGTGTGTGGGGCTCATGAATGCC
CACAGCATGGGCATCGGGGGTGGCCTCTTCCTCACCATCTACAACAGCACCACACGAAAA
GCTGAGGTCATCAAYGCCCGCGAGGTGGCCCCCAGGCTGGCCTTTGCCASCATGTTCAAC
AGCTCGGAGCAGTCCCAGAAGGGRGGGCTGTCGGTGGCGGTGCCTGGGGAGATCCGAGGC
TATGAGCTGGCACACCAGCGGCATGGGCGGCTGCCCTGGGCTCGCCTCTTCCAGCCCAGC
ATCCAGCTGGCCCGCCAGGGCTTCCCCGTGGGCAAGGGCTTGGCGGCAGTCCTGGAAAAC
AAGCGGACCGTCATCGAGCAGCAGCCTGTCTTGTGTGAGGTGTTCTGCCGGGATAGAAAG
GTGCTTCGGGAGGGGGAGAGACTGACCCTGCCGCRGCTGGCTGACACCTACGAGAYGCTG
GCCATCGAGGGTGCCCAGGCCTTCTACAACGGCAGCCTCAYGGCCCAGATTGTGAAGGAC
ATCCAGGCGGCYGGGGGCATTGTGACAGCTGAGGACCTGAACAACTACCGTGCTGAGCTG
ATCGAGCACCCGCTGAACATCAGCCTGGGAGACGYGGTGCTGTACATGCCCAGTGCGCSG
CTCAGCGGGCCCGTGCTGGCCCTCATCCTCAACATCCTCAAAGGGTACAACTTCTCCCGG
GAGAGCGTGGAGASCCCCGAGCAGAAGGGCCTGACGTACCACCGCATCGTAGAGGCTTTC
CGGTTTGCCTACGCCAAGAGGACCCTGCTTGGGGACCCCAAGTTTGTGGATGTGACTGAG
GTGGTCCGCAACATGACCTCYGAGTTCTTCGCTGCCCAGCTCCGGKCCCAGATCTCTGAC
SACACCACTCACCCGATCTCCTACTACAAGCCCGAGTTCTACACGCCGGATGACGGGGGC
ACTGCTCACCTGTCTGTCGTCGCAGAGGACGGCAGTGCTGTGTCCGCCACCAGCACCATC
AACCTCTACTTTGGCTCCAAGGTCYGCTCCCCGGTCAGCGGGATCCTGTTCAATAATGAA
ATGGACGACTTCAGCTCTCCCAGCATCACCAAYGAGTTTGGGGYACCCCCCTCACCTGCC
AATTTCATCCAGCCAGGGAAGCAGCCGCTCTYGTCCATGTGCCYGACGATCATGGTGGGC
CAGGACGGCCAGGTCCGGATGGTGGTGGGAGCTGCTGGGGGCACRCAGATCACCACRGMC
ACTGCACTGGCCATCATCTACAACCTCTGGTTCGGCTATGACGTGAAGMGGGCCGTGGAG
GAGCCCCGGCTGCACAACMAGCTTCTGCCCAACGTCACGACAGTGGAGAGAAACATTGAC
CAGGCAGTGACTGCAGCCCTGGAGACCCGGCACCATCACACCCAGATCGCGTCCACCTTC
ATCGCTGTGGTGCAAGCCATCGTCCGCACGGCTGGTGGCTGGGCAGCTGCCTCGGACTCC
AGGAAAGGCGGGGAGCCTGCCGGCTACTGA

Clone variation with respect to NM_005265.2
122 c=>n;123 t=>n;124 g=>n;125 c=>n;315 c=>y;350 c=>s;384 g=>r;530 c=>t;635 a=>r;656 c=>y;701 c=>y;732 c=>y;815 t=>y;839 c=>s;914 g=>s;1041 c=>y;1066 g=>k;1081 g=>s;1225 c=>y;1293 c=>y;1304 t=>y;1352 c=>y;1364 c=>y;1425 a=>r;1437 g=>r;1439 c=>m;1489 c=>m;1519 c=>m
5' Read Nucleotide Sequence
>OriGene 5' read for NM_005265 unedited
NCGTGTCAAATTTGTATACGACTCACTATAGGCGGCCGCGATTCGGCACGAGGCCTGCAC
CCTGTGCAGATGCCTCCCACTGTCCGCCGGGGCTGCTGGGCACGCCCTGGCTGGTCTCTT
GGACTAGCGGGTGCAGCCCAGAACTGTCTTCTGAGGAAGAGGTGCTCTCCTGGGCCCCCA
CTGTCCCCAGGCCTCAGCAGCAAGGCAAGTGAGGTGCTGCCGTCATCCAGGCTGGACAGT
TCAGTGATTTGCCTGAGGCCCCACAGCAGAGTTCAACTGGAGACAGAGAAACCAGCTAGA
GGCAGAGGGAGGTAACACGGAGTCCCCCAGAAAGGTCTGGGCTGCGCGTGCTTCAGGTAA
CCTCCCTTGACCTTCAGGAGAACGAGAAGGCTGCCTGATCAGAGAGTCCCTGAAGAAGAT
TCTGTGGCTACAGGCTTCAGCAGAGTGTGAGGGAGACCCCGGTTATTTCCTCAGCTATTT
CCACCAAATCCTCCTGTCTTTCGTGGCCAACACCCCAGGCAAGGCTTGGGGCCCCCGTCT
GCTGCTGGACGCAGAGCCATGAAGAAGAAGTTAGTGGTGCTGGGCCTGCTGGCCGTGGTC
CTGGTGCTGGTCATTGTCGGCCTCTGTCTCTGGCTGCCCTCAGCCTCCAAGGAACCTGAC
AACCATGTGTACACCAGGGCTGCCGTGGCCGCGGATGCCAAGCAGTGCTCGAAGATTGGG
AGGGATGCACTGCGGGACGGTGGCTCTGCGGTGGATGCAGCCATTGCAGCCCTGGTGTGT
GTGGNGCTCATGAATGCCCACAGCATGGGCATCGGNGGTGGCCTCTTTCCTCACCATCTA
CACAGCACCACACGAAAAAGCTGAGTCATCAACGCCCGCGAGGTGGCCCCCAGNCTGGCC
TTTGCCACCAA
3' Read Nucleotide Sequence
>OriGene 3' read for NM_005265 unedited
GGCCAGGAAGGCCCCTGGNGNNCCTGGCACAGTGGCCTCATTTATTGTGCTGCTCTGCTG
CTCACAGGGGAAGCCGGTCCCCCANAGTCCCCTTCCTGGTCCTGGTGAGTATCTTGTCCC
TGGATTGCTTGTCAGCCTTGTCCTCCTGGAGCACTCAGTAGCCGGCAGGCTCCCCGCCTT
TCCTGGAGTCCGAGGCAGCTGCCCAGCCACCAGCCGTGCGGACGATGGCTTGCACCACAG
CGATGAAGGTGGACGCGATCTGGGTGTGATGGTGCCGGGTCTCCAGGGCTGCAGTCACTG
CCTGGTCAATGTTTCTCTCCACTGTCGTGACGTTGGGCAGAAGCTGGTTGTGCAGCCGGG
GCTCCTCCACGGCCCGCTTCACGTCATAGCCGAACCAGAGGTTGTAGATGATGGCCAGTG
CAGTGGCCGTGGTGATCTGTGTGCCCCCAGCAGCTCCCACCACCATCCGGACCTGGCCGT
CCTGGCCCACCATGATCGTCGGGCACATGGACGAGAGCGGCTGCTTCCCTGGCTGGATGA
AATTGGCAGGTGAGGGGGGTACCCCAAACTCGTTGGTGATGCTGGGAGAGCTGAAGTCGT
CCATTTCATTATTGAACAGGATCCCGCTGACCGGNGAGCGGACCTTGGAGCCAAAGTANA
GGTTGATGGTGCTGGTGGCGGACACAGCACTGCCGTCCTCTGCGACGACAGACAGGTGAG
CAGTGCCCCCGTCATCCCGCGTGTAGAACTCGGGCTTGTANTANGAGATCGGGTGAGTGG
TGTCGTCAGAGATCTGGGCCCGGGNAGCTGGCAGCGAAGAACTCGNAGGTCATGTTGCGG
ACCACCTCAGTCCATCCACAAACTTGGGGTCCCAAGCAGGTTCTCTTGCCGTAGGCAACC
GGAAACCTCTACATGCGGTGGACCTCAGCCCTTTGTTCGGGCTTCCCGCCCTCCGGAAAA
TTGCCCCTTTAGATGTGAGGATAGGCCNCACGCCCTCTGACGGCCCTGGCATGTCCA
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_005265
ORF Size 1710 bp
Insert Size 2870
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_005265.2, NP_005256
RefSeq Size 2431
Locus ID 2678
Cytogenetics 22q11.23
Domains G_glu_transpept
Protein Families Transmembrane, Protease
Protein Pathways Taurine and hypotaurine metabolism, Selenoamino acid metabolism, Cyanoamino acid metabolism, Glutathione metabolism, Arachidonic acid metabolism, Metabolic pathways
Gene Summary The enzyme encoded by this gene is a type I gamma-glutamyltransferase that catalyzes the transfer of the glutamyl moiety of glutathione to a variety of amino acids and dipeptide acceptors. The enzyme is composed of a heavy chain and a light chain, which are derived from a single precursor protein. It is expressed in tissues involved in absorption and secretion and may contribute to the etiology of diabetes and other metabolic disorders. Multiple alternatively spliced variants have been identified. There are a number of related genes present on chromosomes 20 and 22, and putative pseudogenes for this gene on chromosomes 2, 13, and 22. [provided by RefSeq, Jan 2014].
Transcript Variant: This variant (1) represents the longest transcript. Variants 1, 3, 4, and 5 all encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.