DP2(TFDP2) (NM_006286) Human Untagged Clone

CAT#: SC108572

TFDP2 (untagged)-Human transcription factor Dp-2 (E2F dimerization partner 2) (TFDP2), transcript variant 2

USD 196.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name DP2(TFDP2) (NM_006286) Human Untagged Clone
Symbol TFDP2
Synonyms DP2; DP2
Vector pCMV6-XL6
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_006286, the custom clone sequence may differ by one or more nucleotides


ATGATTATAAGCACACCACAGAGACTAACCAGTTCAGGAAGTGTTCTGATTGGGAGTCCATATACCCCTG
CACCAGCAATGGTTACTCAGACACACATAGCAGAAGCTACTGGCTGGGTCCCTGGTGATAGAAAACGGGC
TAGAAAATTTATAGACTCTGATTTTTCAGAAAGTAAACGAAGCAAAAAAGGAGATAAAAATGGGAAAGGC
TTGAGACACTTTTCAATGAAAGTGTGTGAGAAAGTTCAACGAAAAGGTACAACATCGTACAATGAAGTCG
CTGATGAGCTGGTGTCAGAGTTCACCAATTCAAATAACCATTTGGCTGCTGATTCGCAGGCTTATGATCA
GAAGAACATTAGGCGAAGAGTTTATGATGCTTTAAATGTGCTAATGGCAATGAACATAATTTCAAAGGAA
AAAAAAGAAATCAAGTGGATTGGCCTGCCTACCAATTCTGCTCAGGAATGTCAGAATCTGGAGATAGAGA
AGCAGAGGCGGATAGAACGGATAAAGCAGAAGCGGGCCCAGCTGCAAGAACTTCTCCTACAGCAAATCGC
TTTCAAAAACCTGGTACAGAGAAATCGACAAAATGAGCAGCAAAACCAGGGCCCGCCGGCTCTGAACTCT
ACCATTCAGCTGCCATTCATAATCATCAATACAAGCAGAAAAACAGTCATAGATTGCAGCATCTCCAGTG
ACAAGTTTGAGTATCTTTTCAATTTTGACAACACCTTTGAGATCCATGATGACATAGAAGTACTAAAGCG
GATGGGAATGTCGTTTGGCCTGGAGTCAGGCAAATGCTCTCTGGAGGATCTGAAACTTGCGAAATCCCTG
GTGCCAAAGGCTTTAGAAGGTTATATCACAGATATCTCCACAGGACCTTCTTGGTTAAATCAGGGACTAC
TTCTGAACTCTACCCAATCAGTTTCAAATTTAGACCTGACCACTGGTGCCACCTTACCCCAGTCAAGTGT
AAACCAAGGGTTATGCTTGGATGCAGAAGTGGCCTTAGCAACTGGGCAGTTCCTGGCCCCAAACAGTCAC
CAGTCCAGCAGTGCGGCCTCTCACTGCTCCGAGTCCCGAGGCGAGACCCCCTGTTCGTTCAATGATGAAG
ATGAGGAAGATGATGAGGAGGATTCCTCCTCCCCAGAATAA


5' Read Nucleotide Sequence
>OriGene 5' read for NM_006286 unedited
CTCTTTAACCCGCCCCGTTGNCCCAAAGGGCGGTAGGCGTGTACGGTGGGNAGGTCTATA
TAAGCAGAGCTCATTTAGGTGACACTATAGAATACAAGCTACTTGTTCTTTTTGCAGCGG
CCGCGAATTCGGCACGAGGCTGCAGTGAGAGGCATGCTTCCTTAGACCAGGCAACATTTC
ATTTGTTGCATTTCCAGTTTCCAATACCAACTCACCTACAAAGATTTTACCAAAAACCTT
AGGACCAATAAATGTGAATGTTGGACCCCAAATGATTATAAGCACACCACAGAGACTAAC
CAGTTCAGGAAGTGTTCTGATTGGGAGTCCATATACCCCTGCACCAGCAATGGTTACTCA
GACACACATAGCAGAAGCTACTGGCTGGGTCCCTGGTGATAGAAAACGGGCTAGAAAATT
TATAGACTCTGATTTTTCAGAAAGTAAACGAAGCAAAAAAGGAGATAAAAATGGGAAAGG
CTTGAGACACTTTTCAATGAAAGTGTGTGAGAAAGTTCAACGAAAAGGTACAACATCGTA
CAATGAAGTCGCTGATGAGCTGGTGTCAGAGTTCACCAATTCAAATAACCATTTGGCTGC
TGATTCGGCTTATGATCAGAAGAACATTAGGCGAAGAGTTTATGATGCTTTAAATGTGCT
AATGGCAATGAACATAATTTCAAAGGAAAAAAAAGAAATCAAGTGGATTGGCCTGCCTAC
CAATTCTGCTCAGGAATGTCAGAATCTGGAGATAGAGAAGCAGAGGCGGATAGAACGGAT
AAAGCAGAAGCGGGCCCAGCTGCAAGAACTTCTCCTACAGCAAATCGCTTTCAAAAACCT
GGTACAGAGAAAATCGACAATGAGCAGCAAAACAGGGCCCGNCGGCTCTNGACTCTACAT
TCAGCTGCCATTCATATCATCAATACAGCAGAAAACAGTCATAGATTG
3' Read Nucleotide Sequence
>OriGene 3' read for NM_006286 unedited
NNAAAATCACTNTGNACCGCGGCCCGCTTNCTANGATCGAGTTTTTTTTTTTTTTTTTTT
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTATTCTTGAAAAAACTTTTCTTTAAAAC
AAAAGTAATGACATTTGGTTCATTTTCACAAATTGCACACTGGGTGAAATCATACAATTA
CTGCAGGGAACTGTAGGCAAGCAATTTGGTCATAGGAATTTGTTTCTTTGGCTTGTTTTA
AATGAAAAAGCTATTTGAAATGCATAGCTTTGATTAACCTAAAGATACAGTTTCCTTCTT
TGTAAAACTCCAAATTTAGGATGCTGGCAAAGGCAGTGCTGGCAAAGTATTTAATGCACA
TGGAAATGCTATTCTATTTTGGCTTCCAAAAGTAGCCCTAGTAAATTCTATGCCCCAATG
CATTGGCTAAAAATAATTTCAGTTTTACTATAAATTATCTAAATGTCACTTAAGTACTTA
AAAAGTAGCGCTCGCTCCTTTCTAAAAACTGTCTAAGGCAGCTGATGCCTAAAGCACCTC
ATCTAGACCTCCAACTAGTTCAACAGTTCAATCTGTGCCCCTCAGCCCAGGACTGCCCTC
AGTATCCCTCACTACACAGCTCCCCTCTCCTGGGGACTTTTCATGTTCATTTCTGCCTTG
TCAAAGGCAGTCCAGGCAAGGAAGAGAAACCTCAGAAACACGATCGTCAAGGACTGCTCC
CGGTAACAATCTCAATTCTAAAAAAATTACATGGGTGTGAAGAACACCAAAAATCCACCT
CACAAAAGAAAATGAGTTGCCCTCCCCTGGCCACTTTTCAGGGATAACCCCCTATCTCCC
CAGAAAGCAGCCTTCCTTGGTATAAAAACACCGCGCCGGGGGCCAAACTTTCATTCCCCC
ATGTAAT
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_006286
ORF Size 1161 bp
Insert Size 2350
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_006286.1, NP_006277
RefSeq Size 2320
Locus ID 7029
Cytogenetics 3q23
Domains E2F_TDP
Protein Families Transcription Factors, Druggable Genome
Protein Pathways Cell cycle
Gene Summary The gene is a member of the transcription factor DP family. The encoded protein forms heterodimers with the E2F transcription factors resulting in transcriptional activation of cell cycle regulated genes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2010].
Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Both variants 1 and 2 encode the same protein (isoform 1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.