UQCRH (NM_006004) Human Untagged Clone

CAT#: SC108564

UQCRH (untagged)-Human ubiquinol-cytochrome c reductase hinge protein (UQCRH), nuclear gene encoding mitochondrial protein

USD 402


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name UQCRH (NM_006004) Human Untagged Clone
Symbol UQCRH
Synonyms QCR6; UQCR8
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC108564 sequence for NM_006004 edited (data generated by NextGen Sequencing)
ATGGGACTGGAGGACGAGCAAAAGATGCTTACCGAATCCGGAGATCCTGAGGAGGAGGAA
GAGGAAGAGGAGGAATTAGTGGATCCCCTAACAACAGTGAGAGAGCAATGCGAGCAGTTG
GAGAAATGTGTAAAGGCCCGGGAGCGGCTAGAGCTCTGTGATGAGCGTGTATCCTCTCGA
TCACATACAGAAGAGGATTGCACGGAGGAGCTCTTTGACTTCTTGCATGCGAGGGACCAT
TGCGTGGCCCACAAACTCTTTAACAACTTGAAATAA

Clone variation with respect to NM_006004.2
5' Read Nucleotide Sequence
>OriGene 5' read for NM_006004 unedited
GGTGCANAAATTTGTAATACGACTCACTATAGGGGCGGCCGCGATTCGGCACGAGGGGGT
TAGGTGCCGCTGTTGCTGCTCGTGTTGAATCTAGAACCGTAGCCAGACATGGGACTGGAG
GACGAGCAAAAGATGCTTACCGAATCCGGAGATCCTGAGGAGGAGGAAGAGGAAGAGGAG
GAATTAGTGGATCCCCTAACAACAGTGAGAGAGCAATGCGAGCAGTTGGAGAAATGTGTA
AAGGCCCGGGAGCGGCTAGAGCTCTGTGATGAGCGTGTATCCTCTCGATCACATACAGAA
GAGGATTGCACGGAGGAGCTCTTTGACTTCTTGCATGCGAGGGACCATTGCGTGGCCCAC
AAACTCTTTAACAACTTGAAATAAATGTGTGGACTTAATTCACCCCAGTCTTCATCATCT
GGGCATCAGAATATTTCCTTATGGTTTTGGATGTACCATTTGTTTCTTATTTGTGTAACT
GTAAGTTCACATGAACCTCATGGGTTTGGCTTAGGCTGGTAGCTTCTATGTAATTCGCAA
TGATTCCATCTAAATAAAAGTTCTATGATCTGCAAAAAAAAAAAAAAAAAACTCGACTCT
AGATTGCGGCCGCGGTCATAGCTGTTTCCTGAACAGATCCCGGGTGGCATCCCTGTGACC
CCTCCCCAGTGCCTCTCCTGGCCCTGGAAGTTGGCACTCCAGTGCCCACCAGCCTTGTCC
TATTAAAATTAAGTTGCATCATTTTGTCTGACTAGGTGTCCTTCTATATATTATGGGGTG
GAGGAGGGTGCGTTGGCACCAGCGGCCACGTTGGAAAACACCTCGCAGGCCTGCGGGGCC
TATTGGCAACCAGCCTGAATGCAGTGGCACAACCTTGGCTTCCTGTATCCCCCCCTTCTG
GGTCCAAGCGATCTTCTGCTC
3' Read Nucleotide Sequence
>OriGene 3' read for NM_006004 unedited
TTCTCTGCCACCGCGGCCCGCAATCTANGATCGAGTTTTTTTTTTTTTTTTTTGCAGAAA
TAGAACTTTTATTTAGATGGAATCATTGCGAATTACATAGAAGCTACCAGCCTAAGCCAA
ACCCATGAGGTTCATGTGAACTTACAGTTACACAAATAAGAAACAAATGGTACATCCAAA
ACCATAAGGAAATATTCTGATGCCCAGATGATGAAGACTGGGGTGAATTAAGTCCACACA
TTTATTTCAAGTTGTTAAAGAGTTTGTGGGCCACGCAATGGTCCCTCGCATGCAAGAAGT
CAAAGAGCTTCTCCGTGCAATCCTCTTTTGTATGTGATCGAGAGGATACACGCTCATCAC
AGAGCTCTAGCCGCTCCCGGGCCCTTACACATTTCTTCAACTGCTCGCATTGCTCTCTCA
CTGTTGTTAGGGGATCCACTAATCCCTCCTTTTCCTCTTCCTCCTCCTTAGGATTTCCGG
ATTCCGCAAGCATCTTTTGCTCGCTCTCCAGTCCCATGTCTGGCCACGGTCCTATACTCA
ACACGATCAGCAACAGTGGCACCTAATCCCCTCGTGCCGAATCTCCGGCCCGCCTATAGC
GAGCCGCATTCATCAATTCTGACGGCTCACTAAACGAGCTCTGTTTATATAGACCTCCCA
CCGCACACCCGTATCGCCCATTCTCGTCCACCGGCGTGGGGCTATCACCACATTCCGGCA
AGCCCCGCCGCTTTTTGCCGCCTCAACACACCCTCATTGTCGCTCATGGGCTGTCCCATT
GTAACCCCCCCTGAATTCACACCCTCTCCCGCCCCTTGCGCGATCGCCTAACCCTCTCCC
CCCGTACATACCTTGCACACCCTTTTTATGTCCGCTCCTTTTAAGATTCTCTAGGCCTGC
CCTGCCTAATCGCCGCGCATTTTTCCCCTCTTTGCCCCACCCGCCGCCC
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_006004
ORF Size 276 bp
Insert Size 550
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_006004.1, NP_005995
RefSeq Size 515
RefSeq ORF 276
Locus ID 7388
Cytogenetics 1p33
Domains UCR_hinge
Protein Families Druggable Genome
Protein Pathways Oxidative phosphorylation, Metabolic pathways, Cardiac muscle contraction, Alzheimer's disease, Parkinson's disease, Huntington's disease
Gene Summary This is a component of the ubiquinol-cytochrome c reductase complex (complex III or cytochrome b-c1 complex), which is part of the mitochondrial respiratory chain. This protein may mediate formation of the complex between cytochromes c and c1. [UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) encodes the longest isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.