TGF beta Receptor I(TGFBR1) (NM_004612) Human Untagged Clone

CAT#: SC108520

TGFBR1 (untagged)-Human transforming growth factor, beta receptor 1 (TGFBR1), transcript variant 1

USD 804


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name TGF beta Receptor I(TGFBR1) (NM_004612) Human Untagged Clone
Symbol TGFBR1
Synonyms AAT5; ACVRLK4; ALK-5; ALK5; ESS1; LDS1; LDS1A; LDS2A; MSSE; SKR4; tbetaR-I; TGFR-1
Vector pCMV6-XL4
Sequence Data
Fully Sequenced ORF
>OriGene ORF sequence for NM_004612 edited
ATGGAGGCGGCGGTCGCTGCTCCGCGTCCCCGGCTGCTCCTCCTCGTGCTGGCGGCGGCG
GCGGCGGCGGCGGCGGCGCTGCTCCCGGGGGCGACGGCGTTACAGTGTTTCTGCCACCTC
TGTACAAAAGACAATTTTACTTGTGTGACAGATGGGCTCTGCTTTGTCTCTGTCACAGAG
ACCACAGACAAAGTTATACACAACAGCATGTGTATAGCTGAAATTGACTTAATTCCTCGA
GATAGGCCGTTTGTATGTGCACCCTCTTCAAAAACTGGGTCTGTGACTACAACATATTGC
TGCAATCAGGACCATTGCAATAAAATAGAACTTCCAACTACTGTAAAGTCATCACCTGGC
CTTGGTCCTGTGGAACTGGCAGCTGTCATTGCTGGACCAGTGTGCTTCGTCTGCATCTCA
CTCATGTTGATGGTCTATATCTGCCACAACCGCACTGTCATTCACCATCGAGTGCCAAAT
GAAGAGGACCCTTCATTAGATCGCCCTTTTATTTCAGAGGGTACTACGTTGAAAGACTTA
ATTTATGATATGACAACGTCAGGTTCTGGCTCAGGTTTACCATTGCTTGTTCAGAGAACA
ATTGCGAGAACTATTGTGTTACAAGAAAGCATTGGCAAAGGTCGATTTGGAGAAGTTTGG
AGAGGAAAGTGGCGGGGAGAAGAAGTTGCTGTTAAGATATTCTCCTCTAGAGAAGAACGT
TCGTGGTTCCGTGAGGCAGAGATTTATCAAACTGTAATGTTACGTCATGAAAACATCCTG
GGATTTATAGCAGCAGACAATAAAGACAATGGTACTTGGACTCAGCTCTGGTTGGTGTCA
GATTATCATGAGCATGGATCCCTTTTTGATTACTTAAACAGATACACAGTTACTGTGGAA
GGAATGATAAAACTTGCTCTGTCCACGGCGAGCGGTCTTGCCCATCTTCACATGGAGATT
GTTGGTACCCAAGGAAAGCCAGCCATTGCTCATAGAGATTTGAAATCAAAGAATATCTTG
GTAAAGAAGAATGGAACTTGCTGTATTGCAGACTTAGGACTGGCAGTAAGACATGATTCA
GCCACAGATACCATTGATATTGCTCCAAACCACAGAGTGGGAACAAAAAGGTACATGGCC
CCTGAAGTTCTCGATGATTCCATAAATATGAAACATTTTGAATCCTTCAAACGTGCTGAC
ATCTATGCAATGGGCTTAGTATTCTGGGAAATTGCTCGACGATGTTCCATTGGTGGAATT
CATGAAGATTACCAACTGCCTTATTATGATCTTGTACCTTCTGACCCATCAGTTGAAGAA
ATGAGAAAAGTTGTTTGTGAACAGAAGTTAAGGCCAAATATCCCAAACAGATGGCAGAGC
TGTGAAGCCTTGAGAGTAATGGCTAAAATTATGAGAGAATGTTGGTATGCCAATGGAGCA
GCTAGGCTTACAGCATTGCGGATTAAGAAAACATTATCGCAACTCAGTCAACAGGAAGGC
ATCAAAATGTAA
5' Read Nucleotide Sequence
>OriGene 5' read for NM_004612 unedited
CAGATTTTGTAATACGACTTCACTATAGGGCGGCCGCGNAATTCGCACCAGGCGAGGTTT
GCTGGGGTGAGGCAGCGGCGCGGCCGGGCCGGGCCGGGCCACAGGCGGTGGCGGCGGGAC
CATGGAGGCGGCGGTCGCTGCTCCGCGTCCCCGGCTGCTCCTCCTCGTGCTGGCGGCGGC
GGCGGCGGCGGCGGCGGCGCTGCTCCCGGGGGCGACGGCGTTACAGTGTTTCTGCCACCT
CTGTACAAAAGACAATTTTACTTGTGTGACAGATGGGCTCTGCTTTGTCTCTGTCACAGA
GACCACAGACAAAGTTATACACAACAGCATGTGTATAGCTGAAATTGACTTAATTCCTCG
AGATAGGCCGTTTGTATGTGCACCCTCTTCAAAAACTGGGTCTGTGACTACAACATATTG
CTGCAATCAGGACCATTGCAATAAAATAGAACTTCCAACTACTGTAAAGTCATCACCTGG
CCTTGGTCCTGTGGAACTGGCAGCTGTCATTGCTGGACCAGTGTGCTTCGTCTGCATCTC
ACTCATGTTGATGGTCTATATCTGCCACAACCGCACTGTCATTCACCATCGAGTGCCAAA
TGAAGAGGACCCTTCATTAGATCGCCCTTTTATTTCAGAGGGTACTACGTTGAAAGACTT
AATTTATGATATGACAACGTCAGGTTCTGGCACAGGTTTACCATTGCTTGTTCAGAGAAC
AATTGCGAGAACTATTGTGTTACAAGAAAGCATTGGCAAAGGTCGATTTGGAGAAGTTTG
GAGAGGAAAGTGGCGGGNGAGAAGAAGTTGCTGTTAAGATATTCTCCTCTAGAGAAGACG
TTCGTGGTTCCGTGAGGCAGAGATTNNATCAAACTGTATGTTACGTCATGAAAACATCCT
GNGATTATAGCAGCAGACATAAAGACATGGTACTGGNACTCGCTCTGGNTGTGGCAGATA
TCAGAGCAGGATACCTTTTGGATACTAACAN
3' Read Nucleotide Sequence
>OriGene 3' read for NM_004612 unedited
GCCCAATAGGGGTATTGAATTCCATATTACTGCTGCAAAAGAAAGCCTATCCTTCTGTTC
CCTCTCATGAGGTAGAACAATTGACCTCCCAAATTAAAACCCAGGAGCAGATCTGAAGAA
AAAAGGAGAGTTCAGGCAAAGCTGTAGAATTACATTTTGATGCCTTCCTGTTGACTGAGT
TGCGATAATGTTTTCTTAATCCGCAATGCTGTAAGCCTATCTGCTCCATTGGCATACCAA
CATTCTCTCATAATTTTAGCCATTACTCTCAAGGCTTCACAGCTCTGCCATCTGTTTGGG
ATATTTGGCCTTAACTTCTGTTCACAAACAACTTTTCTCATTTCTTCAACTGATGGGTCA
GAAGGTACAAGATCATAATAAGGCAGTTGGTAATCTTCATGAATTCCACCAATGGAACAT
CGTCGAGCAATTTCCCAGAATACTAAGCCCATTGCATAGATGTCAGCACGTTTGAAGGAT
TCAAAATGTTTCATATTTATGGAATCATCGAGAACTTCAGGGGCCATGTACCTTTTTGTT
CCCACTCTGTGGTTTGGAGCAATATCAATGGTATCTGTGGCTGAATCATGTCTTACTGCC
AGTCCTAAGTCTGCAATACAGCAAGTTCCATTCTTCTTTACCAAGATATTCTTTGATTTC
AAATCTCTATGAGCAATGGCTGGCTTTCCTTGGGTACCAACAATCTCCATGTGAAGATGG
GCAAGACCGCTCGCCGTGGACAGAGCAAGTTTTATCATTCCTTCCACAGTAACTGTGTAT
CTGTTTAAGTAATCAAAAGGGATCCATGCTCATGATAATCTGACACCACCAGAGCTGAGT
CCAATACCATTGTCTTTATTGTCTGCTGCTATAAATCCCAAGATGTTTTCATG
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_004612
ORF Size 1512 bp
Insert Size 2000
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_004612.2, NP_004603
RefSeq Size 6475
RefSeq ORF 1512
Locus ID 7046
Cytogenetics 9q22.33
Domains Activin_recp, pkinase, TyrKc, S_TKc, GS
Protein Families Protein Kinase, Transmembrane, Druggable Genome
Protein Pathways MAPK signaling pathway, Cytokine-cytokine receptor interaction, Endocytosis, TGF-beta signaling pathway, Adherens junction, Pathways in cancer, Colorectal cancer, Pancreatic cancer, Chronic myeloid leukemia
Gene Summary The protein encoded by this gene forms a heteromeric complex with type II TGF-beta receptors when bound to TGF-beta, transducing the TGF-beta signal from the cell surface to the cytoplasm. The encoded protein is a serine/threonine protein kinase. Mutations in this gene have been associated with Loeys-Dietz aortic aneurysm syndrome (LDAS). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2008]
Transcript Variant: This variant (1) encodes the longer isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.