PRKACB (NM_002731) Human Untagged Clone

CAT#: SC108499

PRKACB (untagged)-Human protein kinase, cAMP-dependent, catalytic, beta (PRKACB), transcript variant 2

USD 196


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name PRKACB (NM_002731) Human Untagged Clone
Symbol PRKACB
Synonyms PKA C-beta; PKACB
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>OriGene ORF sequence for NM_002731 edited
ATGGGGAACGCGGCGACCGCCAAGAAAGGCAGCGAGGTGGAGAGCGTGAAAGAGTTTCTA
GCCAAAGCCAAAGAAGACTTTTTGAAAAAATGGGAGAATCCAACTCAGAATAATGCCGGA
CTTGAAGATTTTGAAAGGAAAAAAACCCTTGGAACAGGTTCATTTGGAAGAGTCATGTTG
GTAAAACACAAAGCCACTGAACAGTATTATGCCATGAAGATCTTAGATAAGCAGAAGGTT
GTTAAACTGAAGCAAATAGAGCATACTTTGAATGAGAAAAGAATATTACAGGCAGTGAAT
TTTCCTTTCCTTGTTCGACTGGAGTATGCTTTTAAGGATAATTCTAATTTATACATGGTT
ATGGAATATGTCCCTGGGGGTGAAATGTTTTCACATCTAAGAAGAATTGGAAGGTTCAGT
GAGCCCCATGCACGGTTCTATGCAGCTCAGATAGTGCTAACATTCGAGTACCTCCATTCA
CTAGACCTCATCTACAGAGATCTAAAACCTGAAAATCTCTTAATTGACCATCAAGGCTAT
ATCCAGGTCACAGACTTTGGGTTTGCCAAAAGAGTTAAAGGCAGAACTTGGACATTATGT
GGAACTCCAGAGTATTTGGCTCCAGAAATAATTCTCAGCAAGGGCTACAATAAGGCAGTG
GATTGGTGGGCATTAGGAGTGCTAATCTATGAAATGGCAGCTGGCTATCCCCCATTCTTT
GCAGACCAACCAATTCAGATTTATGAAAAGATTGTTTCTGGAAAGGTCCGATTCCCATCC
CACTTCAGTTCAGATCTCAAGGACCTTCTACGGAACCTGCTGCAGGTGGATTTGACCAAG
AGATTTGGAAATCTAAAGAATGGTGTCAGTGATATAAAAACTCACAAGTGGTTTGCCACG
ACAGATTGGATTGCTATTTACCAGAGGAAGGTTGAAGCTCCATTCATACCAAAGTTTAGA
GGCTCTGGAGATACCAGCAACTTTGATGACTATGAAGAAGAAGATATCCGTGTCTCTATA
ACAGAAAAATGTGCAAAAGAATTTGGTGAATTTTAA
5' Read Nucleotide Sequence
>OriGene 5' read for NM_002731 unedited
GTAATACGACTCACTTATAGGGCGGCCGCGAATTCGCACGAGGCTTCCCTTCCCTGACCC
CTTCTTGCCATCGCCCCAGACTGGGGAACGCGGCGACCGCCAAGAAAGGCAGCGAGGTGG
AGAGCGTGAAAGAGTTTCTAGCCAAAGCCAAAGAAGACTTTTTGAAAAAATGGGAGAATC
CAACTCAGAATAATGCCGGACTTGAAGATTTTGAAAGGAAAAAAACCCTTGGAACAGGTT
CATTTGGAAGAGTCATGTTGGTAAAACACAAAGCCACTGAACAGTATTATGCCATGAAGA
TCTTAGATAAGCAGAAGGTTGTTAAACTGAAGCAAATAGAGCATACTTTGAATGAGAAAA
GAATATTACAGGCAGTGAATTTTCCTTTCCTTGTTCGACTGGAGTATGCTTTTAAGGATA
ATTCTAATTTATACATGGTTATGGAATATGTCCCTGGGGGTGAAATGTTTTCACATCTAA
GAAGAATTGGAAGGTTCAGTGAGCCCCATGCACGGTTCTATGCAGCTCAGATAGTGCTAA
CATTCGAGTACCTCCATTCACTAGACCTCATCTACAGAGATCTAAAACCTGAAAATCTCT
TAATTGACCATCAAGGCTATATCCAGGTCACAGACTTTGGGTTTGCCAAAAGAGTTAAAG
GCAGAACTTGGACATTATGTGGAACTCCAGAGTATTTGGCTCCAGAAATAAATTCTCAGC
AGGGCTACAATAAGGCAGTGGATTGGTGGGCATTANGAGTGCTAATCTATGAAATGGCAG
CTGGCTATCCCCCATTCTTTGCAGACCAACCAATTCAGATTATGAAAAGATTGNTCTGGA
AAGGTCCGATCCCATCCACTTCATTCAGATCTCAGGACTTCTACGNACTGCTGCAGGTGG
ATTGACAAGAATTNGAATCTAGGAAGGTGGCAGGATATAAACCCN
3' Read Nucleotide Sequence
>OriGene 3' read for NM_002731 unedited
NNNNTTTTTTTNNTNNNNNNNNNTTTTTNNNTNTNNNNTTTTTTTTTTTTTTTTTTTTAA
AATATTTTATACGAATGATGTTTTAAATTTATTAACATGACGATATGCCTTTGTTACACA
AAACTTGCTAGAGCAGAGTATTTTATTTTTTTCTTGCACGTTTTAAATATAGATGGACCA
GTGAAATCAATATCAGCATTTACATGACATTACCATGCAGAAACACTTGATAACCGAAAG
ACATATAGATTGGTAGAAAGAACATCTCAAACAGGTTTTTTTTATGTCTTCAAAGGTTTC
ACCAGGGTGTGGTACAGATGAAAAGAAGTGGTGTTAATGACCTACCTGCGCCGATAATAA
AGCAAATAGAAGGATTATATACATTAAGCATCAGCTTGACTAAAAATAAACTCTAAATGC
AGGTAAATTGATCATTAGAATGAACCCAGTTTATCTCTTCTCGTGTGTTGTTTTAAGGTA
GCTCGCTGGACCCCAGAGTTTATATCGAATGGTAAATATTACCGCCCGGCGAAGCAACGC
AACCAGTGGGCTCAACGCTGGGTTCCTAAGCAATACGTAACCAGATACTCTGAAGCGGCC
GGGATTTGCACACGCCGGCGAGACTTCGAGTCGCGTGCGAAAAAGCCCGCGACGGAAGCC
CCACGGGCGCGGAGCTGGTGGGTTGCGGGGGAACGAGGGCCGCGTGGGCGGGCCTAGCGG
CGAGAGGACAGAGTTGTGGGACGGCTGAGACCAACAAACACCTGATGCAACGAGCTGAGC
CCGAAGTAAAAAACAGGAGGGACTATATAAAATAAGAATACTGTGCCAAACCACCGAAAT
TCCACCACTGACCCCCGACCATCCCCGCA
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_002731
ORF Size 1056 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_002731.2, NP_002722
RefSeq Size 4529
RefSeq ORF 1056
Locus ID 5567
Cytogenetics 1p31.1
Domains pkinase, S_TK_X, TyrKc, S_TKc
Protein Families Protein Kinase, Druggable Genome
Protein Pathways MAPK signaling pathway, Calcium signaling pathway, Chemokine signaling pathway, Oocyte meiosis, Apoptosis, Vascular smooth muscle contraction, Wnt signaling pathway, Hedgehog signaling pathway, Gap junction, Long-term potentiation, Olfactory transduction, Taste transduction, Insulin signaling pathway, GnRH signaling pathway, Progesterone-mediated oocyte maturation, Melanogenesis, Prion diseases, Vibrio cholerae infection, Dilated cardiomyopathy
Gene Summary The protein encoded by this gene is a member of the serine/threonine protein kinase family. The encoded protein is a catalytic subunit of cAMP (cyclic AMP)-dependent protein kinase, which mediates signalling though cAMP. cAMP signaling is important to a number of processes, including cell proliferaton and differentiation. Multiple alternatively spliced transcript variants encoding distinct isoforms have been observed. [provided by RefSeq, Jul 2014].
Transcript Variant: This variant (2) differs in the 5' exon structure, compared to variant 1. The encoded isoform (2, also known as Cbeta1) has a distinct N-terminus and is shorter than isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.