PRKACB (NM_002731) Human Untagged Clone

CAT#: SC108498

PRKACB (untagged)-ORIGENE UNIQUE VARIANT 1 of Human protein kinase, cAMP-dependent, catalytic, beta (PRKACB),

USD 196.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name PRKACB (NM_002731) Human Untagged Clone
Symbol PRKACB
Synonyms PKA C-beta; PKACB
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_002731, the custom clone sequence may differ by one or more nucleotides


ATGGGGAACGCGGCGACCGCCAAGAAAGGCAGCGAGGTGGAGAGCGTGAAAGAGTTTCTAGCCAAAGCCA
AAGAAGACTTTTTGAAAAAATGGGAGAATCCAACTCAGAATAATGCCGGACTTGAAGATTTTGAAAGGAA
AAAAACCCTTGGAACAGGTTCATTTGGAAGAGTCATGTTGGTAAAACACAAAGCCACTGAACAGTATTAT
GCCATGAAGATCTTAGATAAGCAGAAGGTTGTTAAACTGAAGCAAATAGAGCATACTTTGAATGAGAAAA
GAATATTACAGGCAGTGAATTTTCCTTTCCTTGTTCGACTGGAGTATGCTTTTAAGGATAATTCTAATTT
ATACATGGTTATGGAATATGTCCCTGGGGGTGAAATGTTTTCACATCTAAGAAGAATTGGAAGGTTCAGT
GAGCCCCATGCACGGTTCTATGCAGCTCAGATAGTGCTAACATTCGAGTACCTCCATTCACTAGACCTCA
TCTACAGAGATCTAAAACCTGAAAATCTCTTAATTGACCATCAAGGCTATATCCAGGTCACAGACTTTGG
GTTTGCCAAAAGAGTTAAAGGCAGAACTTGGACATTATGTGGAACTCCAGAGTATTTGGCTCCAGAAATA
ATTCTCAGCAAGGGCTACAATAAGGCAGTGGATTGGTGGGCATTAGGAGTGCTAATCTATGAAATGGCAG
CTGGCTATCCCCCATTCTTTGCAGACCAACCAATTCAGATTTATGAAAAGATTGTTTCTGGAAAGGTCCG
ATTCCCATCCCACTTCAGTTCAGATCTCAAGGACCTTCTACGGAACCTGCTGCAGGTGGATTTGACCAAG
AGATTTGGAAATCTAAAGAATGGTGTCAGTGATATAAAAACTCACAAGTGGTTTGCCACGACAGATTGGA
TTGCTATTTACCAGAGGAAGGTTGAAGCTCCATTCATACCAAAGTTTAGAGGCTCTGGAGATACCAGCAA
CTTTGATGACTATGAAGAAGAAGATATCCGTGTCTCTATAACAGAAAAATGTGCAAAAGAATTTGGTGAA
TTTTAA


5' Read Nucleotide Sequence
>OriGene 5' read for NM_002731 unedited
NTTCGTTANATTTTGNTATACGACTCACTTATAGGGCGGCCGCGAATTCGCACGAGGATA
TGAAGGAGGCTGGGATAACTANGCTTGAAAAAAATTCAGTCTAGTTATAGACATCTTTGG
CATTAATCTGATGTTTACTAGTGATATCTCATGCTAGGCAGTTATGCTTTGCTTCTAGGG
GCTTCTCTTTTTAAAACAAAAGAAAGCTCTTTTCGTTTTCTGTGTGCTGCATGCTCCAGT
GTGTGTGTTTACACCATCGGTTCTTCTCCCTCTAGAGATTAGCATAACTCCCTTTGCTGT
TGGATTGTTATTTTGAGCAATATGTTTTGGAAAGGTTGGTTTTCATCATGAGTGCTTGCT
CCTCTTCAGAAATATCTGATTCCTTTGTGAAAGAGTTTCTAGCCAAAGCCAAAGAAGACT
TTTTGAAAAAATGGGAGAATCCAACTCAGAATAATGCCGGACTTGAAGATTTTGAAAGGA
AAAAAACCCTTGGAACAGGTTCATTTGGAAGAGTCATGTTGGTAAAACACAAAGCCACTG
AACAGTATTATGCCATGAAGATCTTAGATAAGCAGAAGGTTGTTAAACTGAAGCAAATAG
AGCATACTTTGAATGAGAAAAGAATATTACAGGCAGTGAATTTTCCTTTCCTTGTTCGAC
TGGAGTATGCTTTTAAGGATAATTCTAATTTATACATGGTTATGGAATATGTCCCTGGGG
GTGAAATGTTTTCACATCTAAGAGAATTGGAAGGTTCAGTGAGCCCCATGCACGGTTCTA
TGCAGCTCAGATAGTGCTAACATTCGAGTACCTNCATTCACTAGACCTCATCTACAGAGA
TCTAAACCTNGAAATCTCTTAATTGACCATCANGGCATATNCCAGTACAGACTTTTGGGT
TGCCAAAGAGTAAAGGCAGACTTGACATTATGTGACTCCANATATTG
3' Read Nucleotide Sequence
>OriGene 3' read for NM_002731 unedited
CGGCCGCAATCTAGNATCGAGTTTTTTTTTTTTTTTTTTGTCTTATCCATTGAAGGTACT
TTAATTTTGCAGTTATTGATTAATTAAAAAACACAGTTGTTTTCAGCATTTCCTAGCTAC
AGTAGTGCATAGGAAATTCCATTCTAAACAAAGAAGTAATTAATGAAATAACAACACACC
TTAACATTTTACATTGATAGGTTACAGTTTACAAGGTGCTTTCACATACATTATTTCATT
TGATTCTTACAACAAGCAGAAAAAACAGTGGGAAAGATTTTTTTTTTCAGGCTTACAATG
AGTATTTTCAGGCCAATGGGCAGTTAACACAAGAATATACCAAGAATGAGACAGCAATAC
CCATAAGCCACAATATCGTTTTTGGTAGGTTGACAGTTTGATTCAACTGGGTATTCAGCA
TCGGTGAGTGAGAAAGGAATTAGGACAGACACCAAGGCTCTTATGATATTCAAATAATTT
TAAGAACACTGTCAGAGATAAGAAGAAAGATGCCCTAAAATATATTGCCTTATTGAGACT
TACTTCAAAGCAATATACCCTTCAAAATATCAGATAAAAAGACAATCTTGTCATCGACTG
TGAAANGTANGAGGGAATCTACAAACTGCCTAATCCAGTTCTTCCATTNTACAGACAAGA
GAACTGAGGCTGAGATCATACTGATAGTTTTCCAGCCTGAAATTCAGATGTCTGACTTTC
AGTCTAGGGCTCCTTCTTACACATGCCATCTCTTAATATTTACTGAGCATAACATATATC
TNCTGGTTCAATATGNTATTTTGGNTAAATACTGANTNATGCNTACTACTTNCTATNCAA
AAGTTTTATCTATTCTTGGCTAAANTGTGGCTGAACTGGGAATGTNACATACTTAAAAAT
TCTAATTANGGACCTGGATGGCAAAAATGACTCCTTGACATTTTGCTATGNCAAGCTGCT
NCCGGCTTAAATAAGAGTAATGGATGGCTGAATGCCTCAACCACGCTGGCTAGGTAACTT
ACTAGGGNATCTCCGCTGGCCCTANNATTCATAAAAAATATTTTTAATCTA
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_002731
ORF Size 1056 bp
Insert Size 4350
OTI Disclaimer The sequence of an 'OriGene Unique Variant' differs significantly from the associated reference. It represents a novel splice variant from the same gene locus of the reference. Although such variants are true transcripts and present opportunity for discoveries, they are not yet curated by NCBI and should not be used if the exact reference accession sequence is required.
OTI Annotation This TrueClone was found to represent an alternative form of the specific reference to which it is associated. Its Open Reading Frame (ORF) may represent a novel form or alternative splice variant. By virtue of it being a true transcript (cDNA clone not PCR product), it provides a biologically relevant copy of its mRNA template. For more details, please evaluate the sequence information provided on this website or contact our customer care specialists.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_002731.2, NP_002722
RefSeq Size 4529
Locus ID 5567
Cytogenetics 1p31.1
Domains pkinase, S_TK_X, TyrKc, S_TKc
Protein Families Protein Kinase, Druggable Genome
Protein Pathways MAPK signaling pathway, Calcium signaling pathway, Chemokine signaling pathway, Oocyte meiosis, Apoptosis, Vascular smooth muscle contraction, Wnt signaling pathway, Hedgehog signaling pathway, Gap junction, Long-term potentiation, Olfactory transduction, Taste transduction, Insulin signaling pathway, GnRH signaling pathway, Progesterone-mediated oocyte maturation, Melanogenesis, Prion diseases, Vibrio cholerae infection, Dilated cardiomyopathy
Gene Summary The protein encoded by this gene is a member of the serine/threonine protein kinase family. The encoded protein is a catalytic subunit of cAMP (cyclic AMP)-dependent protein kinase, which mediates signalling though cAMP. cAMP signaling is important to a number of processes, including cell proliferaton and differentiation. Multiple alternatively spliced transcript variants encoding distinct isoforms have been observed. [provided by RefSeq, Jul 2014].
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.