PI 3 Kinase p55 gamma(PIK3R3) (NM_003629) Human Untagged Clone

CAT#: SC108470

PIK3R3 (untagged)-Human phosphoinositide-3-kinase, regulatory subunit 3 (gamma) (PIK3R3), transcript variant 1

USD 721.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name PI 3 Kinase p55 gamma(PIK3R3) (NM_003629) Human Untagged Clone
Symbol PIK3R3
Synonyms p55; p55-GAMMA; p55PIK
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_003629 edited
GAATTCGGCACGAGGGGAGCCCGAGTCCCGGCCTCTGGGGGATTCGCTCTCTGCAGACCA
GTGGGACCCCGAAACTTGAACGCAATCTCCAGCCCCCTTTTTTGCCTTCCTTTGTCACTT
GCCCGGGTTTCTCCCAACGTGTTCTTTTTTTTCCTCTTCATTCTCCCTCCTTCGAAGGAC
ACAAAAGTGGCTTCCGCGGAAAGATTTGGAGGCGGTGGGAGCTTTTCTCCCCGGAGAGCG
ACTGTGTAGAAAGGATTTTTGGGAAGCCGCTTTTTAACACCTCTGCTCTCCGTCCCCCAA
GCCTCTGTGTAATCCTCTGAGGAGAAAAGCCCATAGCTTGAAAGTTCGGGGGCATTTTGT
TGTGTTCTGTAGGAGAGAGGGGGAGGACCCTGTTCGGGTAGTTTGGCCGGACTGGTACTG
GCCGTTGGAAAACCCGAAGTACATTTCCGTGTGGAACTTTTGCAGATATATATTTTTAGA
TTTTTAAATACCAGATAAAAAATATATGCCTTCTATATATCTCCTGGCGACCTGCCCCTG
ACAGCGCGATGTACAATACGGTGTGGAGTATGGACCGCGATGACGCAGACTGGAGGGAGC
TCTTCCACCAAAGCCACCTAAGCCAATGACTTCAGCAGTTCCAAATGGAATGAAGGACAG
TTCTGTTTCTCTTCAGGATGCAGAATGGTACTGGGGGGATATTTCAAGGGAGGAGGTAAA
TGACAAATTGCGGGATATGCCAGATGGGACCTTCTTGGTCCGAGATGCCTCAACAAAAAT
GCAGGGAGATTATACTTTGACTTTGCGGAAGGGAGGCAATAATAAGTTAATAAAGATCTA
TCACCGGGATGGTAAATATGGCTTTTCTGATCCTCTGACATTTAATTCCGTGGTGGAGCT
CATTAACCACTATCACCATGAATCTCTTGCTCAGTACAATCCCAAACTTGATGTGAAGCT
GATGTACCCAGTGTCCAGATACCAACAGGATCAGTTGGTAAAAGAAGATAATATTGATGC
AGTAGGTAAAAAACTGCAAGAATACCACTCTCAGTATCAGGAGAAGAGTAAAGAGTATGA
TAGGCTGTATGAAGAATATACTAGAACATCCCAGGAAATACAGATGAAGAGGACTGCAAT
AGAAGCTTTTAATGAAACAATTAAAATATTTGAAGAGCAGTGTCACACACAAGAACAACA
TAGCAAAGAATATATTGAGCGATTTCGCAGAGAGGGGAATGAAAAGGAGATTGAACGAAT
TATGATGAATTATGATAAATTGAAATCACGTCTGGGTGAGATTCATGATAGCAAAATGCG
TCTAGAGCAGGATTTGAAGAAACAAGCTTTGGACAACCGAGAAATAGATAAAAAAATGAA
TAGTATCAAACCTGACCTGATCCAGCTGCGAAAGATCCGAGATCAACACCTTGTATGGCT
CAATCACAAAGGAGTGAGACAGAAACGCCTGAATGTCTGGCTGGGAATTAAGAATGAGGA
TGCTGATGAGAACTATTTTATCAATGAGGAAGATGAAAACCTGCCCCATTATGATGAGAA
AACCTGGTTTGTTGAGGATATCAATCGAGTACAAGCAGAGGACTTGCTTTATGGGAAACC
TGATGGTGCATTCTTAATTCGTGAGAGTAGCAAGAAAGGATGCTATGCTTGCTCTGTGGT
GGCCGATGGGGAAGTGAAGCACTGTGTGATCTACAGCACTGCTCGGGGCTATGGCTTTGC
AGAGCCCTACAACCTGTACAGCTCTCTGAAGGAGCTAGTGCTCCATTACCAGCAGACATC
CTTGGTTCAGCACAACGACTCCCTCAACGTCAGGCTTGCCTACCCTGTTCATGCACAGAT
GCCCTCGCTTTGCAGATAAAGAGGAAGTGGGAAGAGAGGTGGTTCTCTGGCATTTTTTTC
TACAGTTTTTATTAGACTACGATGAGGGCATTCTTTCTACATAGACTGCTTGTTTTGCAC
AAGAAGTGATTTTGTGAATGTGAAGTGGAGAGGCCGAGCAGCAGCCGGCCGGGATGGGGG
CATTAGAGGCCTGAGGTTCTCTAGGACTCAGCCATGCCGCTGCACTGACATACTAAGCTG
GAAGCAGATGTTTTTTTTXXXXXXXXXXXXXXXXXXCTTTGGCAGTCTCTCTTCCCCCCN
CGAAGAAGGCTGTTTAGGTTTTGTGATAGAATGGGATTTGATGAAAAAGACAACCAAAGG
AAAATGGGGAGGNTTGGGATTTCATTTAAATAATCTAAGCCAAGATGATAAAAAAAACCT
TCAACTGAAGGTACTTTGTTTCTTACCAACATAATTTAGGCTTCAGCATCTCACCAGCCC
CTCCCTCTGAAGAAGTATTATGTTCAGAAGCCAACAAAACAGTTTGTTGCCAGACCAATG
TTTGATGGGAAAACGTGGCACTCATAGTTGAATGTATACTTCTGTACCAAAACTTGAACA
TAAAAAGACTAGAATTTGTGAGTTTTAGCAAACGCTAAAATTGATCACTGTAACTAACCC
CTTCTGTCCTTCCTGCCTGTTTCTCTGAGATGAGGAATAGCATTCTTTTTGTGGGGATGG
TGAGCTTTGAATCATAAAATGAAGTTGGTGCTTGTATGGTGTTTCCTTAGCCTAAAGAAT
GATCTGTTGTTTGAAACCTTTGTAACTTGTTTGTATGAGTAAAGAAAAGGTGCAAAAAAA
AAAAAAAAAAACTCGAC
5' Read Nucleotide Sequence
>OriGene 5' read for NM_003629 unedited
GGTCAAAAATTGTATACGACTCATATAGGGCGGCCGCGAATTCGCACGAGGGAGCCCGAG
TCCCGGCCTCTGGGGGATTCGCTCTCTGCAGACCAGTGGGACCCCGAAACTTGAACGCAA
TCTCCAGCCCCCTTTTTTGCCTTCCTTTGTCACTTGCCCGGGTTTCTCCCAACGTGTTCT
TTTTTTTCCTCTTCATTCTCCCTCCTTCGAAGGACACAAAAGTGGCTTCCGCGGAAAGAT
TTGGAGGCGGTGGGAGCTTTTCTCCCCGGAGAGCGACTGTGTAGAAAGGATTTTTGGGAA
GCCGCTTTTTAACACCTCTGCTCTCCGTCCCCCAAGCCTCTGTGTAATCCTCTGAGGAGA
AAAGCCCATAGCTTGAAAGTTCGGGGGCATTTTGTTGTGTTCTGTAGGAGAGAGGGGGAG
GACCCTGTTCGGGTAGTTTGGCCGGACTGGTACTGGCCGTTGGAAAACCCGAAGTACATT
TCCGTGTGGAACTTTTGCAGATATATATTTTTAGATTTTTAAATACCAGATAAAAAATAT
ATGCCTTCTATATATCTCCTGGCGACCTGCCCCTGACAGCGCGATGTACAATACGGTGTG
GAGTATGGACCGCGATGACGCAGACTGGAGGGAGCTCTTCCACCAAAGCCACCTAAGCCA
ATGACTTCAGCAGTTCCAAATGGAATGAAGGACAGTTCTGTTTCTCTTCAGGATGCAGAA
TGGTACTGGGGGGATATTTCAAGGGAGGAGGGTAATGACAAATTGCGGGATATGCCAGAT
GGGAACCTTCTTGGTCCGAGATGCCTCAACAAAATGCAGGGAGATTATACTTTGACTNTG
CGGAAGGGAGGGCATATAAAGTAATAAAGACTATCACCGNGATGGTAATATGGCTTTTT
3' Read Nucleotide Sequence
>OriGene 3' read for NM_003629 unedited
CCGCGGCCGCAATCTAGAGTCGAGTTTTTTTTTTTTTTTTTTGCACCTTTTCTTTACTCA
TACAAACAAGTTACAAAGGTTTCAAACAACAGATCATTCTTTAGGCTAAGGAAACACCAT
ACAAGCACCAACTTCATTTTATGATTCAAAGCTCACCATCCCCACAAAAAGAATGCTATT
CCTCATCTCAGAGAAACAGGCAGGAAGGACAGAAGGGGTTAGTTACAGTGATCAATTTTA
GCGTTTGCTAAAACTCACAAATTCTAGTCTTTTTATGTTCAAGTTTTGGTACAGAAGTAT
ACATTCAACTATGAGTGCCACGTTTTCCCATCAAACATTGGTCTGGCAACAAACTGTTTT
GTTGGCTTCTGAACATAATACTTCTTCAGAGGGAGGGGCTGGTGAGATGCTGAAGCCTAA
ATTATGTTGGTAAGAAACAAAGTACCTTCAGTTGAAGGTTTTTTTTATCATCTTGGCTTA
GATTATTTAAATGAAATCCCAAGCCTCCCCATTTTCCTTTGGTTGTCTTTTTCATCAAAT
CCCATTCTATCACAAAACCTAAACAGCCTTCTTCGTGGGGGGAAGAGAGACTGCCAAAGC
AAAACACAACTCCCAGCAGAGCCATGCCCCTGCTGCACTCTCAAGAGTTAGATTTTAAAA
AGACATGGTCTCTTCAGAGGCTTCCAAATACAACCCNCACCCGCTATAACCATCAAGCCT
AATATTCTGTTGAGGGTGTCCTGCTAAACAAAACAAAACCCCCATGAAACAGACTTCTAA
AAAACATCTGCTTCCAGCTTATATGTCAATGCACCGGCATGGCTGATTCCTAAAGAACCT
CAGGCCTCTAATGCCCCCATCCCGGNCCGGTTGCTGCTCGGNCTCTCCACTTAACATTAA
CAAAATACCTTCTTGTGGCAAAACAGCGTCTATGTAGAAAGATGCCCTCTTGTAGTCTAT
AAAACTGTAGAAA
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_003629
ORF Size 1386 bp
Insert Size 2940
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_003629.2, NP_003620
RefSeq Size 5621
Locus ID 8503
Cytogenetics 1p34.1
Domains SH2
Protein Families Druggable Genome
Protein Pathways ErbB signaling pathway, Chemokine signaling pathway, Phosphatidylinositol signaling system, mTOR signaling pathway, Apoptosis, VEGF signaling pathway, Focal adhesion, Toll-like receptor signaling pathway, Jak-STAT signaling pathway, Natural killer cell mediated cytotoxicity, T cell receptor signaling pathway, B cell receptor signaling pathway, Fc epsilon RI signaling pathway, Fc gamma R-mediated phagocytosis, Leukocyte transendothelial migration, Neurotrophin signaling pathway, Regulation of actin cytoskeleton, Insulin signaling pathway, Progesterone-mediated oocyte maturation, Type II diabetes mellitus, Pathways in cancer, Colorectal cancer, Renal cell carcinoma, Pancreatic cancer, Endometrial cancer, Glioma, Prostate cancer, Melanoma, Chronic myeloid leukemia, Acute myeloid leukemia, Small cell lung cancer, Non-small cell lung cancer
Gene Summary Phosphatidylinositol 3-kinase (PI3K) phosphorylates phosphatidylinositol and similar compounds, which then serve as second messengers in growth signaling pathways. PI3K is composed of a catalytic and a regulatory subunit. The protein encoded by this gene represents a regulatory subunit of PI3K. The encoded protein contains two SH2 domains through which it binds activated protein tyrosine kinases to regulate their activity. [provided by RefSeq, Jun 2016].
Transcript Variant: This variant (1) represents the longest transcript. Both variants 1 and 2 encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.