NDUFA10 (NM_004544) Human Untagged Clone

CAT#: SC108422

NDUFA10 (untagged)-Human NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 10, 42kDa (NDUFA10), nuclear gene encoding mitochondrial protein

USD 196


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name NDUFA10 (NM_004544) Human Untagged Clone
Symbol NDUFA10
Synonyms CI-42k; CI-42KD
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC108422 sequence for NM_004544 edited (data generated by NextGen Sequencing)
ATGGCCTTGCGGCTCCTGAAGCTGGCAGCGACGTCCGCGTCCGCCCGGGTCGTGGCGGCG
GGCGCCCAGCGCGTGAGAGGAATTCATAGCAGTGTGCAGTGCAAGCTGCGCTATGGAATG
TGGCATTTCCTACTTGGGGATAAAGCAAGCAAAAGACTGACAGAACGCAGCAGAGTGATA
ACTGTAGATGGCAATATATGTACTGGAAAAGGCAAACTTGCAAAAGAAATAGCAGAGAAA
CTAGGCTTCAAGCACTTTCCTGAAGCGGGGATTCATTATCCAGACAGTACCACAGGAGAT
GGGAAGCCCCTCGCCACCGACTATAATGGCAACTGTAGTTTGGAGAAATTTTACGATGAT
CCGAGAAGCAATGATGGCAACAGTTACCGCCTGCAGTCCTGGTTGTACAGCAGTCGCCTG
CTGCAGTACTCAGATGCCTTGGAGCACTTGCTGACCACAGGACAAGGTGTTGTGTTGGAG
CGCTCCATCTTCAGTGACTTTGTGTTCCTGGAGGCGATGTACAACCAGGGATTCATCCGA
AAGCAGTGTGTGGACCACTACAACGAGGTGAAGAGCGTCACCATCTGCGATTACCTGCCC
CCCCACCTGGTGATTTACATCGATGTGCCCGTTCCAGAGGTCCAGAGGCGGATTCAGAAG
AAAGGAGATCCACATGAAATGAAGATCACCTCTGCCTATCTACAGGACATTGAGAATGCC
TATAAGAAAACCTTTCTCCCTGAGATGAGTGAAAAATGTGAGGTTTTACAATATTCTGCA
AGGGAAGCTCAAGATTCAAAAAAGGTGGTAGAGGACATTGAATACCTGAAGTTCGATAAA
GGGCCGTGGCTCAAGCAGGACAATCGCACTTTATACCACCTGCGATTACTGGTTCAGGAT
AAGTTTGAGGTGCTGAATTACACAAGCATTCCTATCTTTCTCCCGGAAGTCACCATTGGA
GCTCATCAGACTGACCGTGTCTTACATCAGTTCAGAGAGCTGCCGGGCCGCAAGTACAGC
CCTGGGTACAACACCGAGGTGGGAGACAAGTGGATCTGGCTGAAGTGA

Clone variation with respect to NM_004544.3
105 a=>g
5' Read Nucleotide Sequence
>OriGene 5' read for NM_004544 unedited
TCAGTATATTTGTAATACGCACTCACTATAGGGCGGCCGCGCAATTCGCACGAGGGTAGC
CATGGCCTTGCGGCTCCTGAAGCTGGCAGCGACGTCCGCGTCCGCCCGGGTCGTGGCGGC
GGGCGCCCAGCGCGTGAGAGGAATTCATAGCAGTGTGCAGTGCAAGCTGCGCTATGGAAT
GTGGCATTTCCTACTTGGGGATAAAGCAAGCAAAAGACTGACAGAACGCAGCAGAGTGAT
AACTGTAGATGGCAATATATGTACTGGAAAAGGCAAACTTGCAAAAGAAATAGCAGAGAA
ACTAGGCTTCAAGCACTTTCCTGAAGCGGGGATTCATTATCCAGACAGTACCACAGGAGA
TGGGAAGCCCCTCGCCACCGACTATAATGGCAACTGTAGTTTGGAGAAATTTTACGATGA
TCCGAGAAGCAATGATGGCAACAGTTACCGCCTGCAGTCCTGGTTGTACAGCAGTCGCCT
GCTGCAGTACTCAGATGCCTTGGAGCACTTGCTGACCACAGGACAAGGTGTTGTGTTGGA
GCGCTCCATCTTCAGTGACTTTGTGTTCCTGGAGGCGATGTACAACCAGGGATTCATCCG
AAAGCAGTGTGTGGACCACTACAACGAGGTGAAGAGCGTCACCATCTGCGATTACCTGCC
CCCNCACCTGGTGATTTACATCGATGTGCCCGTTCCAGAGGTCCAGAGGCGGATTCAGAA
GAAGGAGATCACATGAAATGAAAATCACCTCTGCCTATCTACAGGACATTGAGAATGCCT
ATAAGAAAACCTTTCTNCCTGAGATGAGGTGAAAATGTGAGGTTTTACAATATTCTGCAG
GGGAAGCTTCAGATTCAAAAAGGTGGTAGAAGACAATGAATACCTGAAGTNCGATAAAGG
GCGTGGCTCAAGCACGACAATGCCCTTTATACACTGCGATACTG
3' Read Nucleotide Sequence
>OriGene 3' read for NM_004544 unedited
ATGGACCGCGGGCCGCAATCTAAAGTCGAGTTTTTTTTTTTTTTTTTTCCCATGGAAACA
CTTTTATTTCTGGAAGTCAGAAGAAAAACAATGTGCACAACCTGAATGACACAGAGCGGC
AGCGCTGAAACCACAGGGGCTGCCGAGAGCTGGCCTTTCACAGCAGACCACTGTTTTCCA
GTGAGAATGGTGGGCCATTCCAAAACAAAGCTAAAGGGTTCCAAACATCCAGAATGGAAG
CTGCTTCCCCCAACTCCATTACCTATACTACAGGATGGATTGCTTTTTGTGAGACCCCTT
CTTCCACTGTGCAATTTTTGCATTATTTACCCTCCCCCGATCTTAAAGCTATATGGCGTC
CAGGAGAGTGCGGCTGATGCAGCTTGGCCATCACTGTGATGCAGCTGGAGCAGAAGGCGG
CCCGTTCACTTCAGCCAGATCCACTTGTCTCCCACCTCGGTGTTGTACCCAGGGCTGTAC
TTGCGGCCCGGCAGCTCTCTGAACTGATGTAAGACACGGTCAGTCTGATGAGCTCCAATG
GTGACTTCCGGGAGAAAGATAGGAATGCTTGTGTAATTCAGCACCTCAAACTTATCCTGA
ACCAGTAATCGCAGGTGGTATAAAGTGCGATTGTCCTGCTTGAGCCACGCCCCTTTATCG
AACTCCAGGTATTCAATGTCCTCTACCACCTTTTTTGAATCTTGAGCTTCCCTTGCAGAA
TATTGTAAAACCTCACATTTTTCACTCATCTCAGGGAAAAAGGTTTCTTATAGGCATTCT
CAATGTCCTGTANATAGCAGAGGTGATCTTCATTCCTGGGGATCTCTTTCTTCTGAACCG
NCTCTGCACTNTTGGACGGCCCATCGATGTAATCCCAGGTGGG
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_004544
ORF Size 1068 bp
Insert Size 1530
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_004544.2, NP_004535
RefSeq Size 1557
RefSeq ORF 1068
Locus ID 4705
Cytogenetics 2q37.3
Domains dNK
Protein Pathways Oxidative phosphorylation, Metabolic pathways, Alzheimer's disease, Parkinson's disease, Huntington's disease
Gene Summary The protein encoded by this gene is a component of 42 kDa complex I, the first enzyme complex in the electron transport chain of mitochondria. This protein has NADH dehydrogenase activity and oxidoreductase activity. It transfers electrons from NADH to the respiratory chain. A mutation in this gene was found in an individual with Leigh syndrome. [provided by RefSeq, Apr 2016].
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.