C9orf72 (NM_145005) Human Untagged Clone

CAT#: SC108239

C9orf72 (untagged)-Human chromosome 9 open reading frame 72 (C9orf72), transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: C9orf72
• Synonyms: ALSFTD; DENND9; DENNL72; FTDALS; FTDALS1
• Vector: pCMV6-XL4
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >OriGene ORF within SC111893 sequence for NM_018325 edited
  (data generated by NextGen Sequencing)
  ATGTCGACTCTTTGCCCACCGCCATCTCCAGCTGTTGCCAAGACAGAGATTGCTTTAAGTGGCAAATCAC
  CTTTATTAGCAGCTACTTTTGCTTACTGGGACAATATTCTTGGTCCTAGAGTAAGGCACATTTGGGCTCC
  AAAGACAGAACAGGTACTTCTCAGTGATGGAGAAATAACTTTTCTTGCCAACCACACTCTAAATGGAGAA
  ATCCTTCGAAATGCAGAGAGTGGTGCTATAGATGTAAAGTTTTTTGTCTTGTCTGAAAAGGGAGTGATTA
  TTGTTTCATTAATCTTTGATGGAAACTGGAATGGGGATCGCAGCACATATGGACTATCAATTATACTTCC
  ACAGACAGAACTTAGTTTCTACCTCCCACTTCATAGAGTGTGTGTTGATAGATTAACACATATAATCCGG
  AAAGGAAGAATATGGATGCATAAGGAAAGACAAGAAAATGTCCAGAAGATTATCTTAGAAGGCACAGAGA
  GAATGGAAGATCAGGGTCAGAGTATTATTCCAATGCTTACTGGAGAAGTGATTCCTGTAATGGAACTGCT
  TTCATCTATGAAATCACACAGTGTTCCTGAAGAAATAGATATAGCTGATACAGTACTCAATGATGATGAT
  ATTGGTGACAGCTGTCATGAAGGCTTTCTTCTCAAGTAA
  
  Clone variation with respect to NM_018325.2
  870 c=>y
• Restriction Sites: NotI-NotI
• ACCN: NM_145005
• Insert Size: 3400 bp
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_145005.1, NP_659442.1
• RefSeq Size: 1840 bp
• RefSeq ORF: 510 bp
• Locus ID: 203228
• UniProt ID: Q96LT7
• Cytogenetics: 9p21.2
• Gene Summary: The protein encoded by this gene plays an important role in the regulation of endosomal trafficking, and has been shown to interact with Rab proteins that are involved in autophagy and endocytic transport. Expansion of a GGGGCC repeat from 2-22 copies to 700-1600 copies in the intronic sequence between alternate 5' exons in transcripts from this gene is associated with 9p-linked ALS (amyotrophic lateral sclerosis) and FTD (frontotemporal dementia) (PMID: 21944778, 21944779). Studies suggest that hexanucleotide expansions could result in the selective stabilization of repeat-containing pre-mRNA, and the accumulation of insoluble dipeptide repeat protein aggregates that could be pathogenic in FTD-ALS patients (PMID: 23393093). Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2016]
  Transcript Variant: This variant (1) lacks multiple exons in the central and 3' coding regions, and its 3' terminal exon extends beyond a splice site that is used in variant 3 . This results in a novel 3' UTR, compared to variant 3. It encodes isoform b which is significantly shorter, and its C-terminal amino acid is distinct, compared to isoform a.