PPAR gamma (PPARG) (NM_138711) Human Untagged Clone

CAT#: SC108192

PPARG (untagged)-Human peroxisome proliferator-activated receptor gamma (PPARG), transcript variant 3

USD 196.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name PPAR gamma (PPARG) (NM_138711) Human Untagged Clone
Symbol PPARG
Synonyms CIMT1; GLM1; NR1C3; PPARG1; PPARG2; PPARgamma
Vector pCMV6-XL4
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_138711 edited
CAGAAGCCTGCATTTCTGCATTCTGCTTAATTCCCTTTCCTTAGATTTGAAAGAAGCCAA
CACTAAACCACAAATATACAACAAGGCCATTTTCTCAAACGAGAGTCAGCCTTTAACGAA
ATGACCATGGTTGACACAGAGATGCCATTCTGGCCCACCAACTTTGGGATCAGCTCCGTG
GATCTCTCCGTAATGGAAGACCACTCCCACTCCTTTGATATCAAGCCCTTCACTACTGTT
GACTTCTCCAGCATTTCTACTCCACATTACGAAGACATTCCATTCACAAGAACAGATCCA
GTGGTTGCAGATTACAAGTATGACCTGAAACTTCAAGAGTACCAAAGTGCAATCAAAGTG
GAGCCTGCATCTCCACCTTATTATTCTGAGAAGACTCAGCTCTACAATAAGCCTCATGAA
GAGCCTTCCAACTCCCTCATGGCAATTGAATGTCGTGTCTGTGGAGATAAAGCTTCTGGA
TTTCACTATGGAGTTCATGCTTGTGAAGGATGCAAGGGTTTCTTCCGGAGAACAATCAGA
TTGAAGCTTATCTATGACAGATGTGATCTTAACTGTCGGATCCACAAAAAAAGTAGAAAT
AAATGTCAGTACTGTCGGTTTCAGAAATGCCTTGCAGTGGGGATGTCTCATAATGCCATC
AGGTTTGGGCGGATGCCACAGGCCGAGAAGGAGAAGCTGTTGGCGGAGATCTCCAGTGAT
ATCGACCAGCTGAATCCAGAGTCCGCTGACCTCCGGGCCCTGGCAAAACATTTGTATGAC
TCATACATAAAGTCCTTCCCGCTGACCAAAGCAAAGGCGAGGGCGATCTTGACAGGAAAG
ACAACAGACAAATCACCATTCGTTATCTATGACATGAATTCCTTAATGATGGGAGAAGAT
AAAATCAAGTTCAAACACATCACCCCCCTGCAGGAGCAGAGCAAAGAGGTGGCCATCCGC
ATCTTTCAGGGCTGCCAGTTTCGCTCCGTGGAGGCTGTGCAGGAGATCACAGAGTATGCC
AAAAGCATTCCTGGTTTTGTAAATCTTGACTTGAACGACCAAGTAACTCTCCTCAAATAT
GGAGTCCACGAGATCATTTACACAATGCTGGCCTCCTTGATGAATAAAGATGGGGTTCTC
ATATCCGAGGGCCAAGGCTTCATGACAAGGGAGTTTCTAAAGAGCCTGCGAAAGCCTTTT
GGTGACTTTATGGAGCCCAAGTTTGAGTTTGCTGTGAAGTTCAATGCACTGGAATTAGAT
GACAGCGACTTGGCAATATTTATTGCTGTCATTATTCTCAGTGGAGACCGCCCAGGTTTG
CTGAATGTGAAGCCCATTGAAGACATTCAAGACAACCTGCTACAAGCCCTGGAGCTCCAG
CTGAAGCTGAACCACCCTGAGTCCTCACAGCTGTTTGCCAAGCTGCTCCAGAAAATGACA
GACCTCAGACAGATTGTCACGGAACACGTGCAGCTACTGCAGGTGATCAAGAAGACGGAG
ACAGACATGAGTCTTCACCCGCTCCTGCAGGAGATCTACAAGGACTTGTACTAGCAGAGA
GTCCTGAGCCACTGCCAACATTTCCCTTCTTCCAGTTGCACTATTCTGAGGGAAAATCTG
ACACCTAAGAAATTTACTGTGAAAAAGCATTTTAAAAAGAAAAGGTTTTAGAATATGATC
TATTTTATGCATATTGTTTATAAAGACACATTTACAATTTACTTTTAATATTAAAAATTA
CCATATTATGAAA
5' Read Nucleotide Sequence
>OriGene 5' read for NM_138711 unedited
CCATATGTATACGACTCACTTATAGGGCGGCCGCGATTCGGCACGAGCAGAAGCCTGCAT
TTCTGCATTCTGCTTAATTCCCTTTCCTTAGATTTGAAAGAAGCCAACACTAAACCACAA
ATATACAACAAGGCCATTTTCTCAAACGAGAGTCAGCCTTTAACGAAATGACCATGGTTG
ACACAGAGATGCCATTCTGGCCCACCAACTTTGGGATCAGCTCCGTGGATCTCTCCGTAA
TGGAAGACCACTCCCACTCCTTTGATATCAAGCCCTTCACTACTGTTGACTTCTCCAGCA
TTTCTACTCCACATTACGAAGACATTCCATTCACAAGAACAGATCCAGTGGTTGCAGATT
ACAAGTATGACCTGAAACTTCAAGAGTACCAAAGTGCAATCAAAGTGGAGCCTGCATCTC
CACCTTATTATTCTGAGAAGACTCAGCTCTACAATAAGCCTCATGAAGAGCCTTCCAACT
CCCTCATGGCAATTGAATGTCGTGTCTGTGGAGATAAAGCTTCTGGATTTCACTATGGAG
TTCATGCTTGTGAAGGATGCAAGGGTTTCTTCCGGAGAACAATCAGATTGAAGCTTATCT
ATGACAGATGTGATCTTAACTGTCGGATCCACAAAAAAAGTAGAAATAAATGTCAGTACT
GTCGGTTTCAGAAATGCCTTGCAGTGNGGATGTCTCATAATGCCATCAGGTTTGGGCGGA
TGCCACAGGCCGAGAAGGAGAAGCTGTTGGCGGAGATCTCCAGTGATATCGACCAGCTGA
ATCCAGAGTCCGCTGACCTCCGGGCCCTGGCAAACATTNGTATGACTCATACATAAAGTC
CTTCCCGCTGACCAAAGCANAGGCGAGGNCGATCTTGACAGGAANNGACACAGACAATCA
CCATTCGTTATCTATGACATGAANNTCCTTATGATGGNAGAAGATANAATCAAGTTCAAC
ACTCACCCCCCTGCAGGAGCAGACCAAGAGG
3' Read Nucleotide Sequence
>OriGene 3' read for NM_138711 unedited
ATCTNTGNNACCGCGGCCGCAATTCTANGATCGAGTTTTTTTTTTTTTTTTTTTCATAAT
ATGGTAATTTTTAATATTAAAAGTAAATTGTAAATGTGTCTTTATAAACAATATGCATAA
AATAGATCATATTCTAAAACCTTTTCTTTTTAAAATGCTTTTTCACAGTAAATTTCTTAG
GTGTCAGATTTTCCCTCAGAATAGTGCAACTGGAAGAAGGGAAATGTTGGCAGTGGCTCA
GGACTCTCTGCTAGTACAAGTCCTTGTAGATCTCCTGCAGGAGCGGGTGAAGACTCATGT
CTGTCTCCGTCTTCTTGATCACCTGCAGTAGCTGCACGTGTTCCGTGACAATCTGTCTGA
GGTCTGTCATTTTCTGGAGCAGCTTGGCAAACAGCTGTGAGGACTCAGGGTGGTTCAGCT
TCAGCTGGAGCTCCAGGGCTTGTAGCAGGTTGTCTTGAATGTCTTCAATGGGCTTCACAT
TCAGCAAACCTGGGCGGTCTCCACTGAGAATAATGACAGCAATAAATATTGCCAAGTCGC
TGTCATCTAATTCCAGTGCATTGAACTTCACAGCAAACTCAAACTTGGGCTNCATAAAGT
CACCAAAAGGCTTTCGCAGGCTCTTTAGAAACTCCCTTGTCATGAAGCCTTGGCCCTCGG
ATATGAGAACCCCATCTTTATTCATCAAGGAGGCCAGCATTGTGTAAATGATCCCGTGGA
CTCCATATTTGAGGAGAGGTACTTGGGCCGTTCAAGTCAGGATTACAAAACCAGGATGCT
TTTNGCATACTCTGTGAACTCCTGCCCAGCCTCCCGGAGCGAAACTGCAGCCCTGAAGAT
GCGGATGGCCACCTTTTGCTCTGCTCTGCAGGGGGTGATGTGTTNGAACCTTGATTTTCC
TCTCCATCCTTAGGGAATCATGGCAAGATACCAAGGGGATTTGCCTGGTGGCTTTCTGGC
AAGACCGCCT
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_138711
ORF Size 1919 bp
Insert Size 1800
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_138711.2, NP_619725
RefSeq Size 1920
Locus ID 5468
Cytogenetics 3p25.2
Domains HOLI, zf-C4
Protein Families Nuclear Hormone Receptor, Transcription Factors, Druggable Genome
Protein Pathways PPAR signaling pathway, Huntington's disease, Pathways in cancer, Thyroid cancer
Gene Summary This gene encodes a member of the peroxisome proliferator-activated receptor (PPAR) subfamily of nuclear receptors. PPARs form heterodimers with retinoid X receptors (RXRs) and these heterodimers regulate transcription of various genes. Three subtypes of PPARs are known: PPAR-alpha, PPAR-delta, and PPAR-gamma. The protein encoded by this gene is PPAR-gamma and is a regulator of adipocyte differentiation. Additionally, PPAR-gamma has been implicated in the pathology of numerous diseases including obesity, diabetes, atherosclerosis and cancer. Alternatively spliced transcript variants that encode different isoforms have been described. [provided by RefSeq, Jul 2008].
Transcript Variant: This variant (3) differs in the 5' UTR and 5' coding region compared to variant 2. Variants 1, 3, and 4 encode the same isoform (1), which has a shorter, distinct N-terminus compared to isoform 2.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.