HSPA5 (NM_005347) Human Untagged Clone

CAT#: SC108086

HSPA5 (untagged)-Human heat shock 70kDa protein 5 (glucose-regulated protein, 78kDa) (HSPA5)

USD 196


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name HSPA5 (NM_005347) Human Untagged Clone
Symbol HSPA5
Synonyms BIP; GRP78; HEL-S-89n; MIF2
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC108086 sequence for NM_005347 edited (data generated by NextGen Sequencing)
ATGAAGCTCTCCCTGGTGGCCGCGATGCTGCTGCTGCTCAGCGCGGCGCGGGCCGAGGAG
GAGGACAAGAAGGAGGACGTGGGCACGGTGGTCGGCATCGACCTGGGGACCACCTACTCC
TGCGTCGGCGTGTTCAAGAACGGCCGCGTGGAGATCATCGCCAACGATCAGGGCAACCGC
ATCACGCCGTCCTATGTCGCCTTCACTCCTGAAGGGGAACGTCTGATTGGCGATGCCGCC
AAGAACCAGCTCACCTCCAACCCCGAGAACACGGTCTTTGACGCCAAGCGGCTCATCGGC
CGCACGTGGAATGACCCGTCTGTGCAGCAGGACATCAAGTTCTTGCCGTTCAAGGTGGTT
GAAAAGAAAACTAAACCATACATTCAAGTTGATATTGGAGGTGGGCAAACAAAGACATTT
GCTCCTGAAGAAATTTCTGCCATGGTTCTCACTAAAATGAAAGAAACCGCTGAGGCTTAT
TTGGGAAAGAAGGTTACCCATGCAGTTGTTACTGTACCAGCCTATTTTAATGATGCCCAA
CGCCAAGCAACCAAAGACGCTGGAACTATTGCTGGCCTAAATGTTATGAGGATCATCAAC
GAGCCTACGGCAGCTGCTATTGCTTATGGCCTGGATAAGAGGGAGGGGGAGAAGAACATC
CTGGTGTTTGACCTGGGTGGCGGAACCTTCGATGTGTCTCTTCTCACCATTGACAATGGT
GTCTTCGAAGTTGTGGCCACTAATGGAGATACTCATCTGGGTGGAGAAGACTTTGACCAG
CGTGTCATGGAACACTTCATCAAACTGTACAAAAAGAAGACGGGCAAAGATGTCAGGAAA
GACAATAGAGCTGTGCAGAAACTCCGGCGCGAGGTAGAAAAGGCCAAACGGGCCCTGTCT
TCTCAGCATCAAGCAAGAATTGAAATTGAGTCCTTCTATGAAGGAGAAGACTTTTCTGAG
ACCCTGACTCGGGCCAAATTTGAAGAGCTCAACATGGATCTGTTCCGGTCTACTATGAAG
CCCGTCCAGAAAGTGTTGGAAGATTCTGATTTGAAGAAGTCTGATATTGATGAAATTGTT
CTTGTTGGTGGCTCGACTCGAATTCCAAAGATTCAGCAACTGGTTAAAGAGTTCTTCAAT
GGCAAGGAACCATCCCGTGGCATAAACCCAGATGAAGCTGTAGCGTATGGTGCTGCTGTC
CAGGCTGGTGTGCTCTCTGGTGATCAAGATACAGGTGACCTGGTACTGCTTGATGTATGT
CCCCTTACACTTGGTATTGAAACTGTGGGAGGTGTCATGACCAAACTGATTCCAAGGAAC
ACAGTGGTGCCTACCAAGAAGTCTCAGATCTTTTCTACAGCTTCTGATAATCAACCAACT
GTTACAATCAAGGTCTATGAAGGTGAAAGACCCCTGACAAAAGACAATCATCTTCTGGGT
ACATTTGATCTGACTGGAATTCCTCCTGCTCCTCGTGGGGTCCCACAGATTGAAGTCACC
TTTGAGATAGATGTGAATGGTATTCTTCGAGTGACAGCTGAAGACAAGGGTACAGGGAAC
AAAAATAAGATCACAATCACCAATGACCAGAATCGCCTGACACCTGAAGAAATCGAAAGG
ATGGTTAATGATGCTGAGAAGTTTGCTGAGGAAGACAAAAAGCTCAAGGAGCGCATTGAT
ACTAGAAATGAGTTGGAAAGCTATGCCTATTCTCTAAAGAATCAGATTGGAGATAAAGAA
AAGCTGGGAGGTAAACTTTCCTCTGAAGATAAGGAGACCATGGAAAAAGCTGTAGAAGAA
AAGATTGAATGGCTGGAAAGCCACCAAGATGCTGACATTGAAGACTTCAAAGCTAAGAAG
AAGGAACTGGAAGAAATTGTTCAACCAATTATCAGCAAACTCTATGGAAGTGCAGGCCCT
CCCCCAACTGGTGAAGAGGATACAGCAGAAAAAGATGAGTTGTAG

Clone variation with respect to NM_005347.4
Tag Tag Free
ACCN NM_005347
ORF Size 1965 bp
Insert Size 2500
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_005347.2, NP_005338
RefSeq Size 3925
RefSeq ORF 1965
Locus ID 3309
Cytogenetics 9q33.3
Domains HSP70
Protein Families Druggable Genome
Protein Pathways Antigen processing and presentation, Prion diseases
Gene Summary The protein encoded by this gene is a member of the heat shock protein 70 (HSP70) family. It is localized in the lumen of the endoplasmic reticulum (ER), and is involved in the folding and assembly of proteins in the ER. As this protein interacts with many ER proteins, it may play a key role in monitoring protein transport through the cell.[provided by RefSeq, Sep 2010].
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations