HSP90AB1 (NM_007355) Human Untagged Clone

CAT#: SC108085

HSP90AB1 (untagged)-Human heat shock protein 90kDa alpha (cytosolic), class B member 1 (HSP90AB1)

USD 196


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name HSP90AB1 (NM_007355) Human Untagged Clone
Symbol HSP90AB1
Synonyms D6S182; HSP84; HSP90B; HSPC2; HSPCB
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>OriGene ORF sequence for NM_007355 edited
ATGCCTGAGGAAGTGCACCATGGAGAGGAGGAGGTGGAGACTTTTGCCTTTCAGGCAGAA
ATTGCCCAACTCATGTCCCTCATCATCAATACCTTCTATTCCAACAAGGAGATTTTCCTT
CGGGAGTTGATCTCTAATGCTTCTGATGCCTTGGACAAGATTCGCTATGAGAGCCTGACA
GACCCTTCGAAGTTGGACAGTGGTAAAGAGCTGAAAATTGACATCATCCCCAACCCTCAG
GAACGTACCCTGACTTTGGTAGACACAGGCATTGGCATGACCAAAGCTGATCTCATAAAT
AATTTGGGAACCATTGCCAAGTCTGGTACTAAAGCATTCATGGAGGCTCTTCAGGCTGGT
GCAGACATCTCCATGATTGGGCAGTTTGGTGTTGGCTTTTATTCTGCCTACTTGGTGGCA
GAGAAAGTGGTTGTGATCACAAAGCACAACGATGATGAACAGTATGCTTGGGAGTCTTCT
GCTGGAGGTTCCTTCACTGTGCGTGCTGACCATGGTGAGCCCATTGGCAGGGGTACCAAA
GTGATCCTCCATCTTAAAGAAGATCAGACAGAGTACCTAGAAGAGAGGCGGGTCAAAGAA
GTAGTGAAGAAGCATTCTCAGTTCATAGGCTATCCCATCACCCTTTATTTGGAGAAGGAA
CGAGAGAAGGAAATTAGTGATGATGAGGCAGAGGAAGAGAAAGGTGAGAAAGAAGAGGAA
GATAAAGATGATGAAGAAAAGCCCAAGATCGAAGATGTGGGTTCAGATGAGGAGGATGAC
AGCGGTAAGGATAAGAAGAAGAAAACTAAGAAGATCAAAGAGAAATACATTGATCAGGAA
GAACTAAACAAGACCAAGCCTATTTGGACCAGAAACCCTGATGACATCACCCAAGAGGAG
TATGGAGAATTCTACAAGAGCCTCACTAATGACTGGGAAGACCACTTGGCAGTCAAGCAC
TTTTCTGTAGAAGGTCAGTTGGAATTCAGGGCATTGCTATTTATTCCTCGTCGGGCTCCC
TTTGACCTTTTTGAGAACAAGAAGAAAAAGAACAACATCAAACTCTATGTCCGCCGTGTG
TTCATCATGGACAGCTGTGATGAGTTGATACCAGAGTATCTCAATTTTATCCGTGGTGTG
GTTGACTCTGAGGATCTGCCCCTGAACATCTCCCGAGAAATGCTCCAGCAGAGCAAAATC
TTGAAAGTCATTCGCAAAAACATTGTTAAGAAGTGCCTTGAGCTCTTCTCTGAGCTGGCA
GAAGACAAGGAGAATTACAAGAAATTCTATGAGGCATTCTCTAAAAATCTCAAGCTTGGA
ATCCACGAAGACTCCACTAACCGCCGCCGCCTGTCTGAGCTGCTGCGCTATCATACCTCC
CAGTCTGGAGATGAGATGACATCTCTGTCAGAGTATGTTTCTCGCATGAAGGAGACACAG
AAGTCCATCTATTACATCACTGGTGAGAGCAAAGAGCAGGTGGCCAACTCAGCTTTTGTG
GAGCGAGTGCGGAAACGGGGCTTCGAGGTGGTATATATGACCGAGCCCATTGACGAGTAC
TGTGTGCAGCAGCTCAAGGAATTTGATGGGAAGAGCCTGGTCTCAGTTACCAAGGAGGGT
CTGGAGCTGCCTGAGGATGAGGAGGAGAAGAAGAAGATGGAAGAGAGCAAGGCAAAGTTT
GAGAACCTCTGCAAGCTCATGAAAGAAATCTTAGATAAGAAGGTTGAGAAGGTGACAATC
TCCAATAGACTTGTGTCTTCACCTTGCTGCATTGTGACCAGCACCTACGGCTGGACAGCC
AATATGGAGCGGATCATGAAAGCCCAGGCACTTCGGGACAACTCCACCATGGGCTATATG
ATGGCCAAAAAGCACCTGGAGATCAACCCTGACCACCCCATTGTGGAGACGCTGCGGCAG
AAGGCTGAGGCCGACAAGAATGATAAGGCAGTTAAGGACCTGGTGGTGCTGCTGTTTGAA
ACCGCCCTGCTATCTTCTGGCTTTTCCCTTGAGGATCCCCAGACCCACTCCAACCGCATC
TATCGCATGATCAAGCTAGGTCTAGGTATTGATGAAGATGAAGTGGCAGCAGAGGAACCC
AATGCTGCAGTTCCTGATGAGATCCCCCCTCTCGAGGGCGATGAGGATGCGTCTCGCATG
GAAGAAGTCGATTAG
5' Read Nucleotide Sequence
>OriGene 5' read for NM_007355 unedited
CCCCCATTCCCACGAGGCCGGCGCATTGTTGGGACTGTCTGGGTATCGGAAAGCAATCCT
ACGTTGCTCACTATTACGTATAATCCTTTTCTTTTCAAGATGCCTGAGGAAGTGCACCAT
GGAGAGGAGGAGGTGGAGACTTTTGCCTTTCATGCAGAAATTGCCCAACTCATGTCCCTC
ATCATCAATACCTTCTATTCCAACAAGGAGATTTTCCTTCGGGAGTTGATCTCTAATGCT
TCTGATGCCTTGGACAAGATTCGCTATGAGAGCCTGACAGACCCTTCGAAGTTGGACAGT
GGTAAAGAGCTGAAAATTGACATCATCCCCAACCCTCATGAACGTACCCTGACTTTGGTA
GACACAGGCATTGGCATGACCAAAGCTGATCTCATAAATAATTTGGGAACCATTGCCAAG
TCTGGTACTAAAGCATTCATGGAGGCTCTTCATGCTGGTGCAGACATCTCCATGATTGGG
CAGTTTGGTGTTGGCTTTTATTCTGCCTACTTGGTGGCAGAGAAAGTGGTTGTGATCACA
AAGCACAACGATGATGAACAGTATGCTTGGGAGTCTTCTGCTGGAAGTTCCTTCACTGTG
CGTGCTGACCATGGTGAGCCCATTGGCAGGGGTACCAAAGTGATCCTCCATCTTAAAGAA
GATCAGACAGAGTACCTAGAATAGAGGCGGGTCAAAGAAGTAGTGAAGAAGCATTCTCAG
TTCATATGCTATCCCATCACCCTTTATTTGGAGAATGAACGAGAGAATGAATTATTGATG
ATGATGCAGAGGAAGAAATAGTGATGAAGAAGAGGAGATAAGATGATGAAGGATAGCCAA
GATCGCAGATGTTGGTTCAGATGATGA
3' Read Nucleotide Sequence
>OriGene 3' read for NM_007355 unedited
CCCCCCCCCCANNNNNCCCNNCCCCNACACCACTTCTTGACTTGCCCCGCGGNCCGCAAT
CTAGGAATCGGGTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTGGATAA
AAACGGGATATTCTTTATTTTGCATACTTTAATTTCAGAACAAAATGAAGAAAATAAAAT
AAACCCCAATACACAACATTCAATCCTGGTGTCAAAAATAAAAAGGGAATGGGGCTTGAC
ACCCTTAATTTACTGGCTTTAACACAAGGACAGGAGAGGGAAAAAAACACTAAACACCAC
CAGGGGGAGCCAGGGGGGACAGGGGCACTCCAGGCTGCAGTGGGAGCCCATGGGGACACT
ATACAAGGGCACAAGTTTTCCAACTATGAACTCCTAACCTAATCGACTTCTTTCATGCGA
GAAGCATCCTTATCGCCCTTGAGAGGGGGGATCTCATCAGGAACTGGAGCATTGGGTTCC
TCTGGTGGCACTTTATTTTCATCAATACCTAAACCTAACTTGATCATGCCATAAATGCGG
GTGGAGTGGGTCTGGGGATCCTCAAGGGAAAAGCCAGAAGATAGCAGGGCGGTTTTAAAC
AGCAGCACCACCAGGGCCTTAACTGGCTTATCATTCTTGGCGGGCTCAACCTTCTGCCGC
AGCGGTTTCACAATGGGGTGGTCAGGGTTGATCTCCAGGTGCTTTTTGCCATCATATAGC
CCCAGGTGGAGTTGTCCCCGAGTGCCCTGGCTTTCATGATCCGCTCCATAATGGCTGGCC
AGCCGTAAGTGCTGGGGCACAAAGCAACAAGGTGAAAAACCACAGTCTATTGGGAGATTG
CCACCTTTTCAACCTTTCTATATAAAAATTCTTTCATTGAGCCTGCAAAGGGTCTAAAAA
CTTTGCCTGGCTCTCTTTCCAATTTTTTTTTTTCCCCCTCAACCTCAGGCAAGTTCAAAC
CCTTCTTGTGTACTGG
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_007355
ORF Size 2175 bp
Insert Size 2640
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_007355.2, NP_031381
RefSeq Size 2567
RefSeq ORF 2175
Locus ID 3326
Cytogenetics 6p21.1
Domains HSP90, HATPase_c
Protein Families Stem cell - Pluripotency, Druggable Genome
Protein Pathways Antigen processing and presentation, NOD-like receptor signaling pathway, Progesterone-mediated oocyte maturation, Pathways in cancer, Prostate cancer
Gene Summary This gene encodes a member of the heat shock protein 90 family; these proteins are involved in signal transduction, protein folding and degradation and morphological evolution. This gene encodes the constitutive form of the cytosolic 90 kDa heat-shock protein and is thought to play a role in gastric apoptosis and inflammation. Alternative splicing results in multiple transcript variants. Pseudogenes have been identified on multiple chromosomes. [provided by RefSeq, Dec 2012].
Transcript Variant: This variant (2) uses an alternate splice site in the 5' UTR, compared to variant 1. Variants 1, 2 and 3 encode the same protein (isoform a).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations