NR2F2 (NM_021005) Human Untagged Clone

CAT#: SC108069

NR2F2 (untagged)-Human nuclear receptor subfamily 2, group F, member 2 (NR2F2), transcript variant 1

USD 196.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name NR2F2 (NM_021005) Human Untagged Clone
Symbol NR2F2
Synonyms ARP1; CHTD4; COUPTFB; COUPTFII; NF-E3; NR2F1; SVP40; TFCOUP2
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_021005, the custom clone sequence may differ by one or more nucleotides


ATGGCAATGGTAGTCAGCACGTGGCGCGACCCCCAGGACGAGGTGCCCGGCTCACAGGGCAGCCAGGCCT
CGCAGGCGCCGCCCGTGCCCGGCCCGCCGCCCGGCGCCCCGCACACGCCACAGACGCCCGGCCAAGGGGG
CCCAGCCAGCACGCCAGCCCAGACGGCGGCCGGTGGCCAGGGCGGCCCTGGCGGCCCGGGTAGCGACAAG
CAGCAGCAGCAGCAACACATCGAGTGCGTGGTGTGCGGAGACAAGTCGAGCGGCAAGCACTACGGCCAGT
TCACGTGCGAGGGCTGCAAGAGCTTCTTCAAGCGCAGCGTGCGGAGGAACCTGAGCTACACGTGCCGCGC
CAACCGGAACTGTCCCATCGACCAGCACCATCGCAACCAGTGCCAGTACTGCCGCCTCAAAAAGTGCCTC
AAAGTGGGCATGAGACGGGAAGCGGTGCAGAGGGGCAGGATGCCGCCGACCCAGCCGACCCACGGGCAGT
TCGCGCTGACCAACGGGGATCCCCTCAACTGCCACTCGTACCTGTCCGGATATATTTCCCTGCTGTTGCG
CGCGGAGCCCTATCCCACGTCGCGCTTCGGCAGCCAATGCATGCAGCCCAACAACATCATGGGTATCGAG
AACATTTGCGAACTGGCCGCGAGGATGCTCTTCAGCGCCGTCGAGTGGGCCCGGAACATCCCCTTCTTCC
CCGACCTGCAGATCACGGACCAGGTGGCCCTGCTTCGCCTCACCTGGAGCGAGCTGTTTGTGTTGAATGC
GGCGCAGTGCTCCATGCCCCTCCACGTCGCCCCGCTCCTGGCCGCCGCCGGCCTGCATGCTTCGCCCATG
TCCGCCGACCGGGTGGTCGCCTTTATGGACCACATACGGATCTTCCAAGAGCAAGTGGAGAAGCTCAAGG
CGCTGCACGTTGACTCAGCCGAGTACAGCTGCCTCAAGGCCATAGTCCTGTTCACCTCAGATGCCTGTGG
TCTCTCTGATGTAGCCCATGTGGAAAGCTTGCAGGAAAAGTCTCAGTGTGCTTTGGAAGAATACGTTAGG
AGCCAGTACCCCAACCAGCCGACGAGATTCGGAAAGCTTTTGCTTCGCCTCCCTTCCCTCCGCACCGTCT
CCTCCTCAGTCATAGAGCAATTGTTTTTCGTCCGTTTGGTAGGTAAAACCCCCATCGAAACCCTCATCCG
GGATATGTTACTGTCCGGCAGCAGTTTTAACTGGCCGTATATGGCAATTCAATAA


5' Read Nucleotide Sequence
>OriGene 5' read for NM_021005 unedited
TAAAATTTGTATACGACTCATATAGGCGGCCGCGACATTCGCACGAGGCTTCTGTCTTGA
AGCCAGACAATCGACTTCAGCTCTCCCTCCCCTCCCTCTTTCTCCACGTTCTGCTCCCAC
TCGCTCTCCTGTCCCCTTCCCCTCCCCTCCCGGCGGAAAGCCCCCCGAAACCAACAAAGC
TGAGCCGAGAGAAACAAACAAAACAAACACACCGGGCCAGACAAGCCATCGACAAAACTT
TGCAAAAGCAAAAACAAAAAAGGAAAAACTAACCAACCTCAACCAACCAGCCCCCGAGCC
ACCCGGGGCGCCCTCCCGCGCCCTCTTGCACCCTCGCACACACAAAAGGCGGCGCGCCGG
AGCCCGAGACCCGGGGAGCCGCCGCCGCCCCGCCGCCGCCCGCAGCCAGGGGAGCAGGAA
GTCCGGACGCAGCCCCCATAGATATGGCAATGGTAGTCAGCACGTGGCGCGACCCCCAGG
ACGAGGTGCCCGGCTCACAGGGCAGCCAGGCCTCGCAGGCGCCGCCCGTGCCCGGCCCGC
CGCCCGGCGCCCCGCACACGCCACAGACGCCCGGCCAAGGGGGCCCAGCCAGCACGCCAG
CCCAGACGGCGGCCGGTGGCCAGGGCGGCCCTGGCGGCCCGGGTAGCGACAAGCAGCAGC
AGCAGCAACACATCGAGTGCGTGGTGTGCGGAGACAAGTCGAGCGGCAAGCACTACGGCC
AGTTCACGTGCGAAGGCTGNCAGAGCTTCTTCAAGCGCAGCGTGCGGAGGAACCTGAGCT
ACACGTGCCGCGCCAACCGGAACTGTCCCATCGACCAGCACCATCGCAACCAGTGCCAGT
ACTGCCGCCTCANAAGTGCCTCAAAGTGGGCATGAAACGGGAAAGCGTGCANNAGGGCAG
GATGCCGNCGACCCANCCGACCACGGGCAGTTNGCGCTGACAACGGGGATCCCTCACT
3' Read Nucleotide Sequence
>OriGene 3' read for NM_021005 unedited
GGACGCGGCCGCAATCTANATCGAGTTTTTTTTTTTTTTTTTTGAAATTACAGTCCATTA
AATTCTTCCCCTCTCTTCTTTTAGCAAACTTGTAACATCCTTTTATACCCTTTCTTAACA
GAAGGAAATTAAGCAAACAAACCAGTCTTTTGCCTTTTCTTTCTCTGTTTCACTCCCCCT
TCTTATTTTATTTATTTATTGAATTGCCATATACGGCCAGTTAAAACTGCTGCCGGACAG
TAACATATCCCGGATGAGGGTTTCGATGGGGGTTTTACCTACCAAACGGACGAAAAACAA
TTGCTCTATGACTGAGGAGGAGACGGTGCGGAGGGAAGGGAGGCGAATCAAAAGCTTTCC
GAATCTCGCCGGCTGGTTGGGGTACTGGCTCCTAACGTATTCTTCCAAAGCACACTGAGA
CTTNTCCTGCAAGCTTTCCACATGGGCTACATCAGAGAGACCACAGGCATCTGAGGTGAA
CAGGACTATGGCCTTGAGGCAGCTGTACTCGGCTGAGCAACGTGCAGCGCCTTGAGCTTC
TTCACTTGCTCTTGGAAGACCGTATGTGGTCCATAAAGGCGACCACCCGGCCGGCGGACA
TGGGCGAAGCATGCAGGCCGGCGGCGGCCATAACCGGTGCGACTTGGAGGGGCATGGACC
ACTGCGCCGAATTAACACAAACAGCTCGCTTCAGGTGAGGCGAAGCAGCGCACCTTGTCC
CTGATCTGCAAGTCCGGGAAGAATGCGATGTCCCGGCCCCCTCGACAGCGCTGAAAGCTT
CCTCCGGGCCAGTTCCAAATGTTCCGAACCCAAGATGTTGCCGCGCTGATGCCTTGCCTG
CCCAACCGGACTGGGAAATGCCTCCGCCCCACAAGCCGGGAAATTATTCCGCACGTTCCC
AGGGGAATCTGAGGGGATCCCCTTGGCACACCCAACTGCCCGGGTCCGTTGTGGCCGGGG
AATCTCGACCTTTGGCCGCTTATCGTCTATGCACATCT
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_021005
ORF Size 1245 bp
Insert Size 2000
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_021005.2, NP_066285
RefSeq Size 3049
Locus ID 7026
Cytogenetics 15q26.2
Domains HOLI, zf-C4
Protein Families Nuclear Hormone Receptor, Transcription Factors, Druggable Genome
Gene Summary This gene encodes a member of the steroid thyroid hormone superfamily of nuclear receptors. The encoded protein is a ligand inducible transcription factor that is involved in the regulation of many different genes. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Mar 2010]
Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (a).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations