Cytochrome C Oxidase subunit VIb (COX6B1) (NM_001863) Human Untagged Clone

CAT#: SC107931

Reviews ()
Write a review

COX6B1 (untagged)-Human cytochrome c oxidase subunit VIb polypeptide 1 (ubiquitous) (COX6B1), nuclear gene encoding mitochondrial protein



  "NM_001863" in other vectors (6)

USD 429.00


Availability*
In Stock

Size
    • 10 ug


Product images

Specifications

Product Data
Product Name Cytochrome C Oxidase subunit VIb (COX6B1) (NM_001863) Human Untagged Clone
Type Human Untagged Clone
Tag Tag Free
Symbol COX6B1
Synonyms COX6B; COXG; COXVIb1; MC4DN7
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Cell Selection None
Sequence Data
>OriGene ORF sequence for NM_001863 edited
ATGGCGGAAGACATGGAGACCAAAATCAAGAACTACAAGACCGCCCCTTTTGACAGCCGC
TTCCCCAACCAGAACCAGACTAGAAACTGCTGGCAGAACTACCTGGACTTCCACCGCTGT
CAGAAGGCAATGACCGCTAAAGGAGGCGATATCTCTGTGTGCGAATGGTACCAGCGTGTG
TACCAGTCCCTCTGCCCCACATCCTGGGTCACAGACTGGGATGAGCAACGGGCTGAAGGC
ACGTTTCCCGGGAAGATCTGA
>OriGene 5' read for NM_001863 unedited
CAGTATTTTGTAATACGACTCACTATAGGGCGGCCGCGAATTCGGCACGAGGCCGACTGT
GGTGTCTTTGCTGAGGGTCACATTGAGCTGCAGGTTGAATCCGGGGTGCCTTTAGGATTC
AGCACCATGGCGGAAGACATGGAGACCAAAATCAAGAACTACAAGACCGCCCCTTTTGAC
AGCCGCTTCCCCAACCAGAACCAGACTAGAAACTGCTGGCAGAACTACCTGGACTTCCAC
CGCTGTCAGAAGGCAATGACCGCTAAAGGAGGCGATATCTCTGTGTGCGAATGGTACCAG
CGTGTGTACCAGTCCCTCTGCCCCACATCCTGGGTCACAGACTGGGATGAGCAACGGGCT
GAAGGCACGTTTCCCGGGAAGATCTGAACTGGCTGCATCTCCCTTTCCTCTGTCCTCCAT
CCTTCTCCCAGGATGGTGAAGGGGGACCTGGTACCCAGTGATCCCCACCCCAGGATCCTA
AATCATGACTTACCTGCTAATAAAAACTCATTGGAAAAAAAAAAAAAAAAAACTCGACTC
TAGATTGCGGCCGCGGTCATAGCTGTTTCCTGAACAGATCCCGGGTGGCATCCCTGTGAC
CCCTCCCCAGTGCCTCTCCTGGCCCTGGAAGTTGCCACTCCAGTGCCCACCAGCCTTGTC
CTAATAAAATTAAGTTGCATCATTTTGTCTGACTAGGTGTCCTTCTTAATATTATGGGGT
GAGGGNGGGGGTTTGTGACACCAGGGGCAAAATTGGGAAAAAAACCTTGTGGGCCTGGCG
GGGGTCTATGGGGACCACACTGGAGGGGAGTGGACCAATCCTGCTCACTGGAATCTCCGC
CTCCTGGGGCCAAGCGATTCTCCTGCCTCAGCTCCCGGGTTGGTTGGGTATTCCAGGCAT
GCATGACCAGCCTAGCTAATTTTGGTTTTTTGGTAAA
>OriGene 3' read for NM_001863 unedited
CCGCGGCCGCAATCTAGAGTCGAGTTTTTTTTTTTTTTTTTTCCAATGAGTTTTTATTAG
CAGGTAAGTCATGATTTAGGATCCTGGGGTGGGGATCACTGGGTACCAGGTCCCCCTTCA
CCATCCTGGGAGAAGGATGGAGGACAGAGGAAAGGGAGATGCAGCCAGTTCAGATCTTCC
CGGGAAACGTGCCTTCAGCCCGTTGCTCATCCCAGTCTGTGACCCAGGATGTGGGGCAGA
GGGACTGGTACACACGCTGGTACCATTCGCACACAGAGATATCGCCTCCTTTAGCGGTCA
TTGCCTTCTGACAGCGGTGGAAGTCCAGGTAGTTCTGCCAGCAGTTTCTAGTCTGGTTCT
GGTTGGGGAAGCGGCTGTCAAAAGGGGCGGTCTTGTAGTTCTTGATTTTGGTCTCCATGT
CTTCCGCCATGGTGCTGAATCCTAAAGGCACCCCGGATTCAACCTGCAGCTCAATGTGAC
CCTCAGNCAAGACACCACAGTCGGCCTCGTGCCGAATTCGCGGCCGCCCTATAGTGAGTC
GTATTACAAAATTCTGACGGTTCACTAAACGAGCTCTGCTTAATAGACCTCCCACCGTAC
ACGCCTACCGCCCATTTGCGTCAACGGCGCGGGGTTATTACCACATTTTGGAAAGCCCGT
TGATTTTGGTGCCACAACAAACTCCCATTGACGTCAAGGGGGTGGAGACCTTGAAATCCC
CGTGAGTCAAACCGCTCTCCCCGCCCATCGGTGTCCTGCCAAAACCCCATCACCTGGGAA
TACCCAGGACTAATCCCCAGTGAACCGCCAAGCCGAAACGCCCCGAGGGCCATGCCTGGG
CCTAAGACCGGCCGCCCTTTCCCGCATGTCCCAATGGGGGCGGCCTGGCTATGACCCTTG
ACGCCCGCAGCGGCCCCTACCGTAAACTCCCCCTGACGCAGGAAAGC
Restriction Sites NotI-NotI     
ACCN NM_001863
Insert Size 560 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001863.3, NP_001854.1
RefSeq Size 578 bp
RefSeq ORF 261 bp
Locus ID 1340
UniProt ID P14854
Cytogenetics 19q13.12
Domains COX6B
Protein Pathways Alzheimer's disease, Cardiac muscle contraction, Huntington's disease, Metabolic pathways, Oxidative phosphorylation, Parkinson's disease
Gene Summary Cytochrome c oxidase (COX), the terminal enzyme of the mitochondrial respiratory chain, catalyzes the electron transfer from reduced cytochrome c to oxygen. It is a heteromeric complex consisting of 3 catalytic subunits encoded by mitochondrial genes and multiple structural subunits encoded by nuclear genes. The mitochondrially-encoded subunits function in electron transfer, and the nuclear-encoded subunits may be involved in the regulation and assembly of the complex. This nuclear gene encodes subunit VIb. Mutations in this gene are associated with severe infantile encephalomyopathy. Three pseudogenes COX6BP-1, COX6BP-2 and COX6BP-3 have been found on chromosomes 7, 17 and 22q13.1-13.2, respectively. [provided by RefSeq, Jan 2010]

Other Versions

Other products for "COX6B1"
Frequently bought together (3)
Anti-COX6B1 Rabbit Polyclonal Antibody
    • 100 ul

USD 380.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 473.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 149.00

Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
Molbio tools