HSPA4 (NM_198431) Human Untagged Clone

CAT#: SC107855

HSPA4 (untagged)-Human heat shock 70kDa protein 4 (HSPA4), transcript variant 2

USD 618.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name HSPA4 (NM_198431) Human Untagged Clone
Symbol HSPA4
Synonyms RY, APG-2, hsp70, hsp70RY, HS24/P52, MGC131852;APG-2; HS24/P52; MGC131852; RY; hsp70; hsp70RY; heat shock 70kD protein 4; heat shock 70kDa protein 4, isoform a; heat shock protein, 110 kDa; heat shock 70kDa protein 4
Vector pCMV6-XL4
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_198431, the custom clone sequence may differ by one or more nucleotides


ATGTCGGTGGTGGGCATAGACCTGGGCTTCCAGAGCTGCTACGTCGCTGTGGCCCGCGCCGGCGGCATCG
AGACTATCGCTAATGAGTATAGCGACCGCTGCACGCCGGCTTGCATTTCTTTTGGTCCTAAGAATCGTTC
AATTGGAGCAGCAGCTAAAAGCCAGGTAATTTCTAATGCAAAGAACACAGTCCAAGGATTTAAAAGATTC
CATGGCCGAGCATTCTCTGATCCATTTGTGGAGGCAGAAAAATCTAACCTTGCATATGATATTGTGCAGT
TGCCTACAGGATTAACAGGTATAAAGGTGACATATATGGAGGAAGAGCAGAATGGACCAGTGGATGGACA
AGGAGACAACCCAGGCCCCCAGGCTGCTGAGCAGGGTACAGACACAGCTGTGCCTTCGGATTCAGACAAG
AAGCTTCCTGAAATGGACATTGATTGA


5' Read Nucleotide Sequence
>OriGene 5' read for NM_198431 unedited
TATACGACTCACTATAGGCGGCCGCGAAATTCGCACGAGGCTCTGGTGCTGCGGCTCCGC
TCTCGTCGCAACGAGATCTTTCGAGATCTTCTCCGCCCCCGCTACCGGCGCCTCCTCTGC
GGCCACTGAGCCGGAGCCGGCCTGAGCAGCGCTCTCGGTTGCAGTACCCACTGGAAGGAC
TTAGGCGCTCGCGTGGACACCGCAAGCCCCTCAGTAGCCTCGGCCCAAGAGGCCTGCTTT
CCACTCGCTAGCCCCGCCGGGGGTCCGTGTCCTGTCTCGGTGGCCGGACCCGGGCCCGAG
CCCGAGCAGTAGCCGGCGCCATGTCGGTGGTGGGCATAGACCTGGGCTTCCAGAGCTGCT
ACGTCGCTGTGGCCCGCGCCGGCGGCATCGAGACTATCGCTAATGAGTATAGCGACCGCT
GCACGCCGGCTTGCATTTCTTTTGGTCCTAAGAATCGTTCAATTGGAGCAGCAGCTAAAA
GCCAGGTAATTTCTAATGCAAAGAACACAGTCCAAGGATTTAAAAGATTCCATGGCCGAG
CATTCTCTGATCCATTTGTGGAGGCAGAAAAATCTAACCTTGCATATGATATTGTGCAGT
TGCCTACAGGATTAACAGGTATAAAGGTGACATATATGGAGGAAGAGCGAAATTTTACCA
CTGAGCAAGTGACTGCCATGCTTTTGTCCAAACTGAAAGAGACAGCCGAAAGTGTTCTTT
AGAAGCCCTGTANTTGACTGGCGTGTTACCGGTCCTTGCTTCTATACTGAGGCAGAAAGA
ACATCAGTGATGGATGCAACACAGATTGGCTGGCTTAAATTGCTGGCGATAAATGAAGAA
CACCCCGGCGTTGCCCCTTGCCTAGGAAATCTAAAACCGGATCTTCT
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_198431
ORF Size 447 bp
Insert Size 5000
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_198431.1, NP_940833
RefSeq Size 1309
Locus ID 3308
Cytogenetics 5q31.1
Protein Families ES Cell Differentiation/IPS, Druggable Genome
Protein Pathways Antigen processing and presentation
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.