BID (NM_197966) Human Untagged Clone

CAT#: SC107715

BID (untagged)-Human BH3 interacting domain death agonist (BID), transcript variant 1

USD 196.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name BID (NM_197966) Human Untagged Clone
Symbol BID
Synonyms FP497
Vector pCMV6-Neo
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_197966 edited
GAATTCGGCAACGAGGGGCCACCCTTGCCGGCGGATCGGAATCCCCGCCCACACCGTGGT
CTTTCCAGCACCGCAGACACCTGCCGGCTCCTCCCGAGCGGAGCTCAGGGCTGACAAAGC
GCGGTCAGAGCGGCCGCTTACTGGGGCTCGCCCGCTCCTTAGAGCACTGGCAATGATGTG
CGGATCCTCGCTGCTGCTGCTGGGAAACTGTTGAGTGGCTGAATGACCCCAGGGGACCCT
GGGAGAGCTCTGAAGCCCTCAGCCACCAAGTGGCTGGGCTGGCAAGGGTTCATTCATTCA
TTCAACAAATACGAATGTGCAGCGGTGCTGGGGTCATGATGGCTCGGTGGGCAGCGAGGG
GCCGGGCCGGCTGGAGGAGCACAGTGCGGATTCTGTCGCCACTGGGACACTGTGAACCAG
GAGTGAGTCGGAGCTGCCGCGCTGCCCAGGCCATGGACTGTGAGGTCAACAACGGTTCCA
GCCTCAGGGATGAGTGCATCACAAACCTACTGGTGTTTGGCTTCCTCCAAAGCTGTTCTG
ACAACAGCTTCCGCAGAGAGCTGGACGCACTGGGCCACGAGCTGCCAGTGCTGGCTCCCC
AGTGGGAGGGCTACGATGAGCTGCAGACTGATGGCAACCGCAGCAGCCACTCCCGCTTGG
GAAGAATAGAGGCAGATTCTGAAAGTCAAGAAGACATCATCCGGAATATTGCCAGGCACC
TCGCCCAGGTCGGGGACAGCATGGACCGTAGCATCCCTCCGGGCCTGGTGAACGGCCTGG
CCCTGCAGCTCAGGAACACCAGCCGGTCGGAGGAGGACCGGAACAGGGACCTGGCCACTG
CCCTGGAGCAGCTGCTGCAGGCCTACCCTAGAGACATGGAGAAGGAGAAGACCATGCTGG
TGCTGGCCCTGCTGCTGGCCAAGAAGGTGGCCAGTCACACGCCGTCCTTGCTCCGTGATG
TCTTTCACACAACAGTGAATTTTATTAACCAGAACCTACGCACCTACGTGAGGAGCTTAG
CCAGAAATGGGATGGACTGAACGGACAGTTCCAGAAGTGTGACTGGCTAAAGCTCGATGT
GGTCACAGCTGTATAGCTGCTTCCAGTGTAGACGGAGCCCTGGCATGTCAACAGCGTTCC
TAGAGAAGACAGGCTGGAAGATAGCTGTGACTTCTATTTTAAAGACAATGTTAAACTTAT
AACCCACTTTAAAATATCTACATTAATATACTTGAATGAAAATGTCAAAAAAAAAAAAAA
AAAACTCGAC
5' Read Nucleotide Sequence
>OriGene 5' read for NM_197966 unedited
NGGGGAAAATTTGTATACGACTCACTATAGGGGCGGCCGCGAATCGGCAACGAGGGGCCA
CCCTTGCCGGCGGATCGGAATCCCCGCCCACACCGTGGTCTTTCCAGCACCGCAGACACC
TGCCGGCTCCTCCCGAGCGGAGCTCAGGGCTGACAAAGCGCGGTCAGAGCGGCCGCTTAC
TGGGGCTCGCCCGCTCCTTAGAGCACTGGCAATGATGTGCGGATCCTCGCTGCTGCTGCT
GGGAAACTGTTGAGTGGCTGAATGACCCCAGGGGACCCTGGGAGAGCTCTGAAGCCCTCA
GCCACCAAGTGGCTGGGCTGGCAAGGGTTCATTCATTCATTCAACAAATACGAATGTGCA
GCGGTGCTGGGGTCATGATGGCTCGGTGGGCAGCGAGGGGCCGGGCCGGCTGGAGGAGCA
CAGTGCGGATTCTGTCGCCACTGGGACACTGTGAACCAGGAGTGAGTCGGAGCTGCCGCG
CTGCCCAGGCCATGGACTGTGAGGTCAACAACGGTTCCAGCCTCAGGGATGAGTGCATCA
CAAACCTACTGGTGTTTGGCTTCCTCCAAAGCTGTTCTGACAACAGCTTCCGCAGAGAGC
TGGACGCACTGGGCCACGAGCTGCCAGTGCTGGCTCCCCAGTGGGAGGGCTACGATGAGC
TGCAGACTGATGGCAACCGCAGCAGCCACTCCCGCTTGGGAAGATAGAGGCAGATTCTTG
AAGTCAAGAAGACCTCATCCGGAATATTGCCCAGCACCCTCGCCCAGGTCGGGGACAGCA
TGGACCCGGACATCCCCTCCGGGCCCGGTGGACCGGGCTGCCCTGGCGCTTAAGAACACC
ACCCCGGCCGGAGGGAGACCGGAACACGGGACCTGCCCACTGCCCTGGGACACCTGCTGC
AGGCCTAC
3' Read Nucleotide Sequence
>OriGene 3' read for NM_197966 unedited
NTTTTACTCTGGNACCGCGGCCGCAATCTAGNATCGAGTTTTTTTTTTTTTTTTTTGACA
TTTTCATTCAAGTATATTAATGTAGATATTTTAAAGTGGGTTATAAGTTTAACATTGTCT
TTAAAATAGAAGTCACAGCTATCTTCCAGCCTGTCTTCTCTAGGAACGCTGTTGACATGC
CAGGGCTCCGTCTACACTGGAAGCAGCTATACAGCTGTGACCACATCGAGCTTTAGCCAG
TCACACTTCTGGAACTGTCCGTTCAGTCCATCCCATTTCTGGCTAAGCTCCTCACGTAGG
TGCGTAGGTTCTGGTTAATAAAATTCACTGTTGTGTGAAAGACATCACGGAGCAAGGACG
GCGTGTGACTGGCCACCTTCTTGGCCAGCAGCAGGGCCAGCACCAGCATGGTCTTCTCCT
TCTCCATGTCTCTAGGGTAGGCCTGCAGCAGCTGCTCCAGGGCAGTGGCCAGGTCCCTGT
TCCGGTCCTCCTCCGACCGGCTGGTGTTCCTGAGCTGCAGGGCCAGGCCGTTCACCAGGC
CCGGAGGGATGCTACGGTCCATGCTGTCCCCGACCTGGGCGAGGTGCCTGGCAATATTCC
GGATGATGTCTTCTTGACTTTCAGAATCTGCCTCTATTCTTCCCAAGCGGGAGTGGCTGC
TGCGGTTGCCATCAGTCTGCAGCTCATCGTAGCCCTCCCACTGGGGAGCCAGCACTGGCA
GCTCGTGGCCCAGTGCGTCCAGCTCTCTGCGGAAGCTGTTGTCAGAACAGCTTTGGAGGA
AGCAAACCCAGTAGGGTTTGTGATGCACTCATCCCTGGAGCTGAAACCGGTTGGTGACCT
CCCAGGTCATGGCCTGGGCAGCGCCGCAGCCTCGACTCACTCTGGGTCACAGGGTCCCCA
GGGGCGACAGA
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_197966
ORF Size 726 bp
Insert Size 1660
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_197966.1, NP_932070
RefSeq Size 2506
Locus ID 637
Cytogenetics 22q11.21
Protein Families Druggable Genome
Protein Pathways p53 signaling pathway, Apoptosis, Natural killer cell mediated cytotoxicity, Alzheimer's disease, Amyotrophic lateral sclerosis (ALS), Pathways in cancer, Viral myocarditis
Gene Summary This gene encodes a death agonist that heterodimerizes with either agonist BAX or antagonist BCL2. The encoded protein is a member of the BCL-2 family of cell death regulators. It is a mediator of mitochondrial damage induced by caspase-8 (CASP8); CASP8 cleaves this encoded protein, and the COOH-terminal part translocates to mitochondria where it triggers cytochrome c release. Multiple alternatively spliced transcript variants have been found, but the full-length nature of some variants has not been defined. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.