MCM4 (NM_182746) Human Untagged Clone

CAT#: SC107549

MCM4 (untagged)-Human minichromosome maintenance complex component 4 (MCM4), transcript variant 2

USD 721.00


Availability*
4 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name MCM4 (NM_182746) Human Untagged Clone
Symbol MCM4
Synonyms CDC21; CDC54; hCdc21; NKCD; NKGCD; P1-CDC21
Vector pCMV6-XL4
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_182746, the custom clone sequence may differ by one or more nucleotides


ATGTCGTCCCCGGCGTCGACCCCGAGCCGCCGCGGCAGCCGGCGTGGAAGGGCCACCCCCGCCCAGACGC
CTCGGAGTGAGGATGCCAGGTCATCTCCCTCTCAGAGACGTAGAGGCGAGGATTCCACCTCCACGGGGGA
GTTGCAGCCGATGCCAACCTCGCCTGGAGTGGACCTGCAGAGCCCTGCTGCGCAGGACGTGCTGTTTTCC
AGCCCTCCCCAAATGCATTCTTCAGCTATCCCTCTTGACTTTGATGTTAGTTCACCACTGACATACGGCA
CTCCCAGCTCTCGGGTAGAGGGAACCCCAAGAAGTGGTGTTAGGGGCACACCTGTGAGACAGAGGCCTGA
CCTGGGCTCTGCACAGAAGGGCCTGCAAGTGGATCTGCAGTCTGACGGGGCAGCAGCAGAAGATATAGTG
GCAAGTGAGCAGTCTCTAGGCCAAAAACTTGTGATCTGGGGAACAGATGTAAATGTGGCAGCATGCAAAG
AAAACTTTCAGAGATTTCTTCAGCGTTTTATTGACCCTCTGGCTAAAGAAGAAGAAAATGTTGGCATAGA
TATTACTGAACCTCTATACATGCAACGACTTGGGGAGATTAATGTTATTGGTGAGCCATTTTTAAATGTG
AACTGTGAACACATCAAATCATTTGACAAAAATTTGTACAGACAACTCATCTCTTACCCACAGGAAGTTA
TTCCAACTTTTGACATGGCTGTCAATGAAATCTTCTTTGACCGTTACCCTGACTCAATCTTAGAACATCA
GATTCAAGTAAGACCATTCAACGCATTGAAGACTAAGAATATGAGAAACCTGAATCCAGAAGACATTGAC
CAGCTCATCACCATCAGCGGCATGGTGATCAGGACATCCCAGCTGATTCCCGAGATGCAGGAGGCCTTCT
TCCAGTGCCAAGTGTGTGCCCACACGACCCGGGTGGAGATGGACCGCGGCCGCATTGCAGAGCCCAGTGT
GTGCGGGCGCTGCCACACCACCCACAGCATGGCACTCATCCACAACCGCTCCCTCTTCTCTGACAAGCAG
ATGATCAAGCTTCAGGAGTCTCCGGAAGACATGCCTGCAGGGCAGACACCACACACAGTTATCCTGTTTG
CTCACAATGATCTCGTTGACAAGGTCCAGCCTGGGGACAGAGTGAATGTTACAGGCATCTATCGAGCTGT
GCCTATTCGAGTCAATCCAAGAGTGAGTAATGTGAAGTCTGTCTACAAAACCCACATTGATGTCATTCAT
TATCGGAAAACGGATGCAAAACGTCTGCATGGCCTTGATGAAGAAGCAGAACAGAAACTTTTTTCAGAGA
AACGTGTGGAATTGCTTAAGGAACTTTCCAGGAAACCAGACATTTATGAGAGGCTTGCTTCAGCCTTGGC
TCCAAGCATTTATGAACATGAAGATATAAAGAAGGGAATTTTGCTTCAGCTCTTTGGCGGGACAAGGAAG
GATTTTAGTCACACTGGAAGGGGCAAATTTCGGGCTGAGATCAACATCTTGCTGTGTGGCGACCCTGGTA
CCAGCAAGTCCCAGCTGCTGCAGTACGTGTACAACCTCGTCCCCAGGGGCCAGTACACGTCTGGGAAGGG
CTCCAGTGCAGTTGGCCTCACTGCGTACGTAATGAAAGACCCTGAGACAAGGCAGCTGGTCCTGCAGACA
GGTGCTCTTGTCCTGAGTGACAACGGCATCTGCTGTATCGATGAGTTCGACAAGATGAATGAAAGTACAA
GATCGGTATTGCATGAAGTCATGGAACAGCAGACTCTGTCCATTGCAAAGGCTGGGATCATCTGTCAGCT
CAATGCGCGCACCTCTGTCCTGGCAGCAGCAAATCCCATTGAGTCTCAGTGGAATCCTAAAAAAACAACC
ATTGAAAACATCCAGCTGCCTCATACTTTATTATCAAGGTTTGATTTGATCTTCCTCTTGCTGGACCCTC
AGGACGAAGCCTATGACAGGCGTCTGGCTCACCACCTGGTCGCACTGTACTACCAGAGCGAGGAGCAGGC
AGAGGAGGAGCTCCTGGACATGGCGGTGCTAAAGGACTACATTGCCTACGCGCACAGCACCATCATGCCG
CGGCTAAGTGAGGAAGCCAGCCAGGCTCTCATCGAGGCTTATGTAGACATGAGGAAGATTGGCAGTAGCC
GGGGAATGGTTTCTGCATACCCTCGACAGCTAGAGTCATTAATCCGCTTAGCAGAAGCCCATGCTAAAGT
AAGATTGTCTAACAAAGTTGAAGCCATTGATGTGGAAGAGGCCAAACGCCTCCATCGGGAAGCTCTGAAG
CAGTCTGCAACTGATCCCCGGACTGGCATCGTGGACATATCTATTCTTACTACGGGGATGAGTGCCACCT
CTCGTAAACGGAAAGAAGAATTAGCTGAAGCATTGAAAAAGCTTATTTTATCTAAGGGCAAAACACCAGC
TCTAAAATACCAGCAACTTTTTGAAGATATTCGGGGACAATCTGACATAGCAATTACTAAAGATATGTTT
GAAGAAGCACTGCGTGCCCTGGCAGATGATGATTTCCTGACAGTGACTGGGAAGACCGTGCGCTTGCTCT
GA


5' Read Nucleotide Sequence
>OriGene 5' read for NM_182746 unedited
ACGAGGGCGCTACTCGCCAGGTGGACTCGGNAGTCCGCGAGCGTCGTCGGCAAGCGGCCG
CCTTTCCACGGTACTCCGAGCACTATGTCGTCCCCGGCGTCGACCCCGAGCCGCCGCGGC
AGCCGGCGTGGAAGGGCCACCCCCGCCCAGACGCCTCGGAGTGAGGATGCCAGGTCATCT
CCCTCTCAGAGACGTAGAGGCGAGGATTCCACCTCCACGGGGGAGTTGCAGCCGATGCCA
ACCTCGCCTGGAGTGGACCTGCAGAGCCCTGCTGCGCAGGACGTGCTGTTTTCCAGCCCT
CCCCAAATGCATTCTTCAGCTATCCCTCTTGACTTTGATGTTAGTTCACCACTGACATAC
GGCACTCCCAGCTCTCGGGTAGAGGGAACCCCAAGAAGTGGTGTTAGGGGCACACCTGTG
AGACAGAGGCCTGACCTGGGCTCTGCACAGAAGGGCCTGCAAGTGGATCTGCAGTCTGAC
GGGGCAGCAGCAGAAGATATAGTGGCAAGTGAGCAGTCTCTAGGCCAAAAACTTGTGATC
TGGGGAACAGATGTAAATGTGGCAGCATGCAAAGAAAACTTTCAGAGATTTCTTCAGCGT
TTTATTGACCCTCTGGCTAAAGAAGAAGAAAATGTTGGCATAGATATTACTGAACCTCTA
TACATGCAACGACTTGGGGGAGATTAATGGTATTGGTGAGCCATTTTTAAATGTGAACTG
NGAAACACATCAAATCATTTGACAAAAATTTGTACAGACAACTTATCTTTTACCCACAGG
AAGNTATTCCAACTTTTGACATGGCTGTCAATGAAATCTTNTTTGANCGGTACCCTGACT
CAATCTTA
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_182746
ORF Size 2592 bp
Insert Size 4700
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_182746.1, NP_877423
RefSeq Size 3417
Locus ID 4173
Cytogenetics 8q11.21
Protein Families Stem cell - Pluripotency, Transcription Factors
Protein Pathways DNA replication, Cell cycle
Gene Summary The protein encoded by this gene is one of the highly conserved mini-chromosome maintenance proteins (MCM) that are essential for the initiation of eukaryotic genome replication. The hexameric protein complex formed by MCM proteins is a key component of the pre-replication complex (pre_RC) and may be involved in the formation of replication forks and in the recruitment of other DNA replication related proteins. The MCM complex consisting of this protein and MCM2, 6 and 7 proteins possesses DNA helicase activity, and may act as a DNA unwinding enzyme. The phosphorylation of this protein by CDC2 kinase reduces the DNA helicase activity and chromatin binding of the MCM complex. This gene is mapped to a region on the chromosome 8 head-to-head next to the PRKDC/DNA-PK, a DNA-activated protein kinase involved in the repair of DNA double-strand breaks. Alternatively spliced transcript variants encoding the same protein have been reported. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) lacks a segment in the 5' UTR, when compared to variant 1. Both variants encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.