CPEB4 (NM_030627) Human Untagged Clone

CAT#: SC107390

CPEB4 (untagged)-Human cytoplasmic polyadenylation element binding protein 4 (CPEB4)

  View "NM_030627" in other vectors (10)

USD 740.00


Availability*
In Stock

Size
    • 10 ug


Product images

Specifications

Product Data
Product Name CPEB4 (NM_030627) Human Untagged Clone
Symbol CPEB4
Synonyms KIAA1673
Vector pCMV6-XL5
Sequence Data
>NCBI ORF sequence for NM_030627, the custom clone sequence may differ by one or more nucleotides


ATGGGGGATTACGGGTTTGGAGTGCTAGTGCAAAGCAATACTGGGAATAAATCTGCTTTTCCAGTCAGAT
TCCATCCACATCTGCAGCCTCCACACCATCACCAAAATGCCACCCCCAGCCCTGCTGCTTTTATAAATAA
TAACACAGCTGCCAATGGCAGCAGTGCTGGGTCAGCTTGGCTTTTTCCTGCTCCAGCTACCCATAACATT
CAGGATGAGATCTTGGGGTCAGAAAAAGCAAAAAGTCAGCAACAGGAACAGCAAGACCCCTTAGAAAAGC
AGCAGCTTTCCCCAAGTCCAGGTCAGGAAGCTGGAATACTGCCTGAAACAGAGAAGGCAAAATCAGAAGA
AAATCAAGGGGACAATTCTTCGGAAAATGGCAATGGGAAGGAGAAAATAAGGATCGAATCTCCAGTGTTG
ACAGGGTTTGATTATCAAGAAGCCACTGGGCTAGGTACTTCAACCCAACCCTTGACATCTAGCGCATCGT
CTCTTACTGGTTTCAGTAACTGGTCAGCAGCGATAGCGCCTTCCTCCTCTACAATAATCAATGAAGATGC
AAGTTTCTTTCACCAGGGAGGGGTCCCTGCTGCTTCGGCTAATAACGGTGCTCTGTTGTTTCAAAATTTC
CCCCATCATGTCAGCCCTGGCTTTGGAGGCAGCTTCTCTCCTCAGATCGGGCCTCTCTCACAGCACCACC
CACATCACCCTCATTTCCAGCATCATCACAGCCAGCATCAGCAGCAAAGGAGGTCTCCTGCCAGTCCCCA
TCCCCCACCCTTCACACATAGAAATGCTGCTTTTAACCAGCTGCCTCATTTGGCGAATAATCTTAACAAA
CCCCCCTCTCCGTGGAGCAGCTACCAGAGTCCGTCACCAACACCCTCCTCTTCCTGGAGCCCGGGCGGTG
GTGGATATGGTGGCTGGGGAGGTTCCCAAGGCCGAGATCACCGCAGAGGGCTGAATGGTGGAATAACGCC
CCTGAACTCCATCTCGCCTTTGAAGAAAAATTTTGCAAGCAATCATATTCAGCTCCAGAAGTATGCTCGC
CCCAGCTCTGCCTTTGCACCTAAATCCTGGATGGAAGATAGCTTGAACAGGGCTGACAACATTTTTCCTT
TTCCGGATCGCCCCAGGACATTCGACATGCACTCACTGGAGAGTTCACTCATTGACATAATGAGAGCTGA
AAATGATACCATTAAAGGTCGTCTAAACTATTCATATCCAGGATCCGATAGCTCTCTGCTTATTAATGCA
AGGACATATGGGCGAAGGAGAGGTCAGTCTTCACTGTTTCCAATGGAAGATGGATTCTTGGATGATGGCC
GTGGGGATCAGCCTCTTCATAGTGGCCTGGGTTCACCTCACTGCTTCAGTCACCAGAATGGGGAAAGAGT
GGAACGATATTCTCGAAAGGTGTTTGTAGGCGGATTGCCTCCAGACATTGATGAAGATGAGATCACAGCT
AGTTTTCGTCGCTTTGGCCCTCTGATTGTGGATTGGCCTCATAAAGCTGAGAGCAAATCCTATTTTCCTC
CTAAAGGCTATGCATTCCTGCTGTTTCAAGATGAAAGCTCTGTGCAGGCTCTCATTGATGCATGCATTGA
AGAAGATGGAAAACTCTACCTTTGTGTATCAAGTCCCACTATCAAGGATAAGCCAGTCCAGATTCGGCCT
TGGAATCTCAGTGACAGTGACTTTGTGATGGATGGTTCACAGCCACTTGACCCACGAAAAACTATATTTG
TTGGTGGTGTTCCTCGACCATTACGAGCTGTGGAGCTTGCGATGATAATGGATCGGCTATATGGAGGTGT
GTGCTACGCTGGGATTGATACCGACCCTGAGCTAAAATACCCAAAAGGAGCTGGGAGAGTTGCGTTCTCT
AATCAACAGAGTTACATAGCTGCTATCAGTGCCCGCTTTGTTCAGCTGCAGCATGGAGAGATAGATAAAC
GGGTGGAAGTTAAGCCATATGTCTTGGATGATCAGCTGTGTGATGAATGTCAGGGGGCCCGTTGTGGGGG
GAAATTTGCTCCATTTTTCTGTGCTAATGTTACCTGTCTGCAGTATTACTGTGAATATTGCTGGGCTGCT
ATCCATTCTCGTGCTGGCAGGGAATTCCACAAGCCCCTGGTGAAGGAAGGCGGTGACCGCCCTCGGCATA
TTTCATTCCGCTGGAACTAA


>OriGene 5' read for NM_030627 unedited
GTATTTTGTAATACGACTCACTATAGGGNNCGGCCGCGCAATTCGGCACGAGGGAAAAAA
AAGCGTGAGACATCAGGTTGTCATTTTTTATTGTGAGATTCTGCTCCTAAAGATAATAAA
TGGGGGATTACGGGTTTGGAGTGCTAGTGCAAAGCAATACTGGGAATAAATCTGCTTTTC
CAGTCAGATTCCATCCACATCTGCAGCCTCCACACCATCACCAAAATGCCACCCCCAGCC
CTGCTGCTTTTATAAATAATAACACAGCTGCCAATGGCAGCAGTGCTGGGTCAGCTTGGC
TTTTTCCTGCTCCAGCTACCCATAACATTCAGGATGAGATCTTGGGGTCAGAAAAAGCAA
AAAGTCAGCAACAGGAACAGCAAGACCCCTTAGAAAAGCAGCAGCTTTCCCCAAGTCCAG
GTCAGGAAGCTGGAATACTGCCTGAAACAGAGAAGGCAAAATCAGAAGAAAATCAAGGGG
ACAATTCTTCGGAAAATGGCAATGGGAAGGAGAAAATAAGGATCGAATCTCCAGTGTTGA
CAGGGTTTGATTATCAAGAAGCCACTGNGCTAGGTACTTCAACCCAACCCTTGACATCTA
GCGCATCGTCTCTTACTGGTTTCAGTAACTGGTCAGCAGCGATAGCGCCTTCCTCCTCTA
CAATAATCAATGAAGATGCAAGTTTCTTTCACCAGGGAGGCGTCCCTGCTGCTTCCGCTA
ATAACCGTGCTCTGNTGTCTCAAAATTCCCCCATCATGTCAGCCCTGGCTTTGGAGGCAG
CTTCTCTTCTCAGATCGGGCCTTTCTCACAGGACCACCCAATCACCCTCATTTCCGCATC
ATTACACCCGCATTAGCAGCAAAGGAGGTCTCCTGCCAATCCCATACCCCACCCTTCAAC
CATAGAATGCTGCTTTTACCCCTTGCCCATTTGGCGAAAATCTTAACAACCCCCCTTCCG
TGGAGCG
>OriGene 3' read for NM_030627 unedited
NNNNNTTTTTAGCTATGNACCGCGGCCCGCATNCTAGGATCGAGTTTTTTTTTTTTTTTT
TTCTGATGTGGTGGTAACTTTTTGAGGGATAATGAAATTATGTTCAGCCTCAAAACCCTG
AAAATTAATTATAATGCTGCTCAGTCTTGCTTATGCATTTGTTTGCTCTAACATGCTCTT
TCCATTAAAAATTGTTAACTTCCTCCATTGCTGTTAAAAAAATTAAAAAGGGATGGAAAA
AAGAGAGAGACAAAAAAGATGAAAAAAAAAAAAAAAAAGAAAGGAAAAGGCAAAAGCACT
TCCCTGGGGGAAAAACTGTCAGATAGACCGATAGTGTTATTGTTGCATGGTTATTTTAAT
AAAAGTATTCTTATATGTTATATTATTAACAATAATTTAATTAAAAACCCAAAATACTCT
ATTGTTTCATTTCTCTTTTAATATTTCTCTCTCTCCTCTAAGAAAATGTTGCAGGAAGTT
TGGATCCTCTTGGTTTCCAGCAAAACAAGAGAATAAAACTTCCATGCAACCCGATGGCAA
TACGAAAAAGGAGTTCATATTGTTTGCAGTGACACAAGAATCTACAAAACACCTATATTA
TAGGTCATTCTTTTCATTATACTATAGTTAAGTTACAGACTGCTACAAAAGGACATGCCA
NCGTGAAGAGGTTGAGGAAGGGGTCAAAATGAACAGAAGAGTGCACTTATTCTGAGGCCT
GAAAATGAGCACTGCAGTTATCCTTTAGTTCCAGCGGAATGAAATATGCCGAGGGCGGTC
ACCGCCTTTCTTCACCAGGGGCTTGTGGGAATTCCCTGCCAGCACGAGAATGTATAGCAG
CCCCAGCATATTCACAGTATACTGCAGACAGGTAACATTAGCACAGAAA
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_030627
ORF Size 2190 bp
Insert Size 2880
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_030627.1, NP_085130
RefSeq Size 6930
RefSeq ORF 2190
Locus ID 80315
Cytogenetics 5q35.2

Other Versions

Other products for "CPEB4"
Frequently bought together (2)
Rabbit Polyclonal Anti-CPEB4 Antibody
    • 100 ul

USD 360.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 Vial

USD 430.00

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
40% off proteins and antibodies
68 Mouse Clones