ANAPC13 (NM_015391) Human Untagged Clone

CAT#: SC107373

ANAPC13 (untagged)-Human anaphase promoting complex subunit 13 (ANAPC13), transcript variant 1

USD 196.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name ANAPC13 (NM_015391) Human Untagged Clone
Symbol ANAPC13
Synonyms APC13; SWM1
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>OriGene ORF sequence for NM_015391 edited
ATGGACAGTGAGGTTCAGAGAGATGGAAGGATCTTGGATTTGATTGATGATGCTTGGCGA
GAAGACAAGCTGCCTTATGAGGATGTCGCAATACCACTGAATGAGCTTCCTGAACCTGAA
CAAGACAATGGTGGCACCACAGAATCTGTCAAAGAACAAGAAATGAAGTGGACAGACTTA
GCCTTACAGTACCTCCATGAGAATGTTCCCCCCATTGGAAACTGA
5' Read Nucleotide Sequence
>OriGene 5' read for NM_015391 unedited
ATTTTGTAATACGACTCACTATAGGGCGGCCGCGAATTCGGCACGAGGGTCTGCCGCGGT
GGCCGGGTGCCGATTTGACAAGATCAAAGCTGCAGGAAAATGGACAGTGAGGTTCAGAGA
GATGGAAGGATCTTGGATTTGATTGATGATGCTTGGCGAGAAGACAAGCTGCCTTATGAG
GATGTCGCAATACCACTGAATGAGCTTCCTGAACCTGAACAAGACAATGGTGGCACCACA
GAATCTGTCAAAGAACAAGAAATGAAGTGGACAGACTTAGCCTTACAGTACCTCCATGAG
AATGTTCCCCCCATTGGAAACTGACGCTTGGCTCCTTTCTTGTGGATGGATTTTCTCAAA
GTACACAGATAAAGCATGGTTTGTTTCAGTCTCCAAATTCAAACCTTTGAGTAATAAATC
AGCACTCAAAAATGTACACCCATTTAGTTTGTGGTAGCAAAGTGCAATGCGAAATTGAAT
GAGAAACTGAGATTTCTCAGTAATGGTGAATATTTCGCTCTTTAAACCTAAAACTCTTCA
TTGAGTAGCTTATATTTGAACATGATTGGTTAAACATTTGCCTCTACCTCTGATTTTGCT
TTGCTGTCAAAGTTTAACACCTTCCAACTACTTATGTGTGTCCTGTAACACAGGTGATTG
AACGTATGAGAGGGAAAGGCAAAGAANAAGGAAGCCAGACACTANGAGAATTATTAACTT
CTCATACTTCCCCACATTGAGAAGCATTCGGAGTGTATTTAGCCTGTAGATGTTGTGATA
TGCAAATATCCCATTCCCTGGNTACTGGCATTCCTAAGATTCTTCATGGNTATTTCAAAC
TTTGGATAAATTACAGATTAAAAGATTCTGACAGTTAT
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_015391
ORF Size 225 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_015391.1, NP_056206
RefSeq Size 1201
Locus ID 25847
Cytogenetics 3q22.2
Protein Pathways Cell cycle, Oocyte meiosis, Ubiquitin mediated proteolysis, Progesterone-mediated oocyte maturation
Gene Summary This gene encodes a component of the anaphase promoting complex, a large ubiquitin-protein ligase that controls cell cycle progression by regulating the degradation of cell cycle regulators such as B-type cyclins. The encoded protein is evolutionarily conserved and is required for the integrity and ubiquitin ligase activity of the anaphase promoting complex. Pseudogenes and splice variants have been found for this gene; however, the biological validity of some of the splice variants has not been determined. [provided by RefSeq, Nov 2008].
Transcript Variant: This variant (1) differs in the 5' UTR compared to variant 2. Variants 1, 2 and 3 encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.