PKIG (NM_181804) Human Untagged Clone

CAT#: SC107349

PKIG (untagged)-Human protein kinase (cAMP-dependent, catalytic) inhibitor gamma (PKIG), transcript variant 3


  "NM_181804" in other vectors (4)

Reconstitution Protocol

USD 150.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "PKIG"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol PKIG
Synonyms PKI-gamma
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_181804, the custom clone sequence may differ by one or more nucleotides


ATGATGGAGGTCGAGTCCTCCTACTCGGACTTCATCTCCTGTGACCGGACAGGCCGTCGGAATGCGGTCC
CTGACATCCAGGGAGACTCAGAGGCTGTGAGCGTGAGGAAGCTGGCTGGAGACATGGGCGAGCTGGCACT
CGAGGGGGCAGAAGGACAGGTGGAGGGAAGCGCCCCAGACAAGGAAGCTGGCAACCAGCCCCAGAGCAGC
GATGGGACCACCTCGTCTTGA


>OriGene 5' read for NM_181804 unedited
TGTAATACGACTCACTATAGGGCGGCCGCGAATTCGGCACGAGGGAGACCGCAGGAGACA
CGGGGAAGAGACAGAGAGGAGGGTAAAGTGAGAATCCTGCCCGCACCACAGGTCTGGACT
GCTAACCTTGAATCCTGGTTTCTTAAATTCTGCCTCCGCTTCTGACTGAGGACCACTGGA
TTTTGAGGAAACTTTGGTCTTAATTCCCGTACTGATTAGTCAACAGTGGAAAATCTGAAG
AGATGCAAGCAGGAAAAAGAAATTAAACCAGGCCTGAGGAGCGATGCGACAGGCATGATG
GAGGTCGAGTCCTCCTACTCGGACTTCATCTCCTGTGACCGGACAGGCCGTCGGAATGCG
GTCCCTGACATCCAGGGAGACTCAGAGGCTGTGAGCGTGAGGAAGCTGGCTGGAGACATG
GGCGAGCTGGCACTCGAGGGGGCAGAAGGACAGGTGGAGGGAAGCGCCCCAGACAAGGAA
GCTGGCAACCAGCCCCAGAGCAGCGATGGGACCACCTCGTCTTGAATCTGACCTTGTCCA
AGAAGGCTGGACGAGAGACCTTCTGTCCCCTCCCAGAGGGGGAACCCTGGCACTGGCCCA
GCAGCCTCTTCTCTGAGCTCCATGTCCCAGATAAACCAGGCCAGACTGAGAAGGCTCCCC
AGAGGCCTCTGTGGCCTNCACTCCGGGAAAGCCCTCTGCCCACACCCACAGGCTTCACAT
TCCCACCACCTTCGCACCGTGCCCAGGTACACTTTCAAGACACTGTTACCACAAGATGTT
ATTATTTGAGCTGGCGCCGGGACTTGGGGCGGGGCCTGCCCTACAGTGAGCAGCCCAACA
GGACGCTTCTCTCGCGAGCGGCCCGGCAGGNACCCTGTCCAACACCACACTNCTTTCAGC
CATNTTNTGGGCCAAACTGCTGTCC
Restriction Sites NotI-NotI     
ACCN NM_181804
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_181804.1, NP_861520.1
RefSeq Size 1353 bp
RefSeq ORF 231 bp
Locus ID 11142
UniProt ID Q9Y2B9
Cytogenetics 20q13.12
Protein Families Druggable Genome
Gene Summary This gene encodes a member of the protein kinase inhibitor family. Studies of a similar protein in mice suggest that this protein acts as a potent competitive cAMP-dependent protein kinase inhibitor, and is a predominant form of inhibitor in various tissues. The encoded protein may be involved in osteogenesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Transcript Variant: This variant (3) differs in the 5' UTR, compared to variant 4. Variants 1-5 encode the same protein.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.