PI 3 Kinase p85 alpha(PIK3R1) (NM_181504) Human Untagged Clone

CAT#: SC107273

PIK3R1 (untagged)-Human phosphoinositide-3-kinase, regulatory subunit 1 (alpha) (PIK3R1), transcript variant 2

USD 721.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name PI 3 Kinase p85 alpha(PIK3R1) (NM_181504) Human Untagged Clone
Symbol PIK3R1
Synonyms AGM7; GRB1; IMD36; p85; p85-ALPHA
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC107273 sequence for NM_181504 edited (data generated by NextGen Sequencing)
ATGTACAATACTGTTTGGAATATGGAAGACCTGGATTTAGAATATGCCAAGACAGATATA
AATTGTGGCACAGACTTGATGTTTTATATAGAAATGGACCCACCAGCACTGCCTCCTAAA
CCACCAAAACCTACTACTGTAGCCAACAACGGTATGAATAACAATATGTCCTTACAAGAT
GCTGAATGGTACTGGGGAGATATCTCGAGGGAAGAAGTGAATGAAAAACTTCGAGATACA
GCAGACGGGACCTTTTTGGTACGAGATGCGTCTACTAAAATGCATGGTGATTATACTCTT
ACACTAAGGAAAGGGGGAAATAACAAATTAATCAAAATATTTCATCGAGATGGGAAATAT
GGCTTCTCTGACCCATTAACCTTCAGTTCTGTGGTTGAATTAATAAACCACTACCGGAAT
GAATCTCTAGCTCAGTATAATCCCAAATTGGATGTGAAATTACTTTATCCAGTATCCAAA
TACCAACAGGATCAAGTTGTCAAAGAAGATAATATTGAAGCTGTAGGGAAAAAATTACAT
GAATATAACACTCAGTTTCAAGAAAAAAGTCGAGAATATGATAGATTATATGAAGAATAT
ACCCGCACATCCCAGGAAATCCAAATGAAAAGGACAGCTATTGAAGCATTTAATGAAACC
ATAAAAATATTTGAAGAACAGTGCCAGACCCAAGAGCGGTACAGCAAAGAATACATAGAA
AAGTTTAAACGTGAAGGCAATGAGAAAGAAATACAAAGGATTATGCATAATTATGATAAG
TTGAAGTCTCGAATCAGTGAAATTATTGACAGTAGAAGAAGATTGGAAGAAGACTTGAAG
AAGCAGGCAGCTGAGTATCGAGAAATTGACAAACGTATGAACAGCATTAAACCAGACCTT
ATCCAGCTGAGAAAGACGAGAGACCAATACTTGATGTGGTTGACTCAAAAAGGTGTTCGG
CAAAAGAAGTTGAACGAGTGGTTGGGCAATGAAAACACTGAAGACCAATATTCACTGGTG
GAAGATGATGAAGATTTGCCCCATCATGATGAGAAGACATGGAATGTTGGAAGCAGCAAC
CGAAACAAAGCTGAAAACCTGTTGCGAGGGAAGCGAGATGGCACTTTTCTTGTCCGGGAG
AGCAGTAAACAGGGCTGCTATGCCTGCTCTGTAGTGGTGGACGGCGAAGTAAAGCATTGT
GTCATAAACAAAACAGCAACTGGCTATGGCTTTGCCGAGCCCTATAACTTGTACAGCTCT
CTGAAAGAACTGGTGCTACATTACCAACACACCTCCCTTGTGCAGCACAACGACTCCCTC
AATGTCACACTAGCCTACCCAGTATATGCACAGCAGAGGCGATGA

Clone variation with respect to NM_181504.3
5' Read Nucleotide Sequence
>OriGene 5' read for NM_181504 unedited
ATTTTGTAATACGACTCACTATAGGGCGGCCGCGAATTCGGCACGAGGGGACTCTTTTCT
TATAACTGAGCTCAGCCAAGGAAACTCTTGCACAAATGTACAATACTGTTTGGAATATGG
AAGACCTGGATTTAGAATATGCCAAGACAGATATAAATTGTGGCACAGACTTGATGTTTT
ATATAGAAATGGACCCACCAGCACTGCCTCCTAAACCACCAAAACCTACTACTGTAGCCA
ACAACGGTATGAATAACAATATGTCCTTACAAGATGCTGAATGGTACTGGGGAGATATCT
CGAGGGAAGAAGTGAATGAAAAACTTCGAGATACAGCAGACGGGACCTTTTTGGTACGAG
ATGCGTCTACTAAAATGCATGGTGATTATACTCTTACACTAAGGAAAGGGGGAAATAACA
AATTAATCAAAATATTTCATCGAGATGGGAAATATGGCTTCTCTGACCCATTAACCTTCA
GTTCTGTGGTTGAATTAATAAACCACTACCGGAATGAATCTCTAGCTCAGTATAATCCCA
AATTGGATGTGAAATTACTTTATCCAGTATCCAAATACCAACAGGATCAAGTTGTCAAAG
AAGATAATATTGAAGCTGTAGGGAAAAAATTACATGAATATAACACTCAGTTTCAAGAAA
AAAGTCGAGAATATGATAGATTATATGAAGAATATACCCGCACATCCCAGGAAATCCAAA
TGAAAAGGACAGCTATTGAAGCATTTAATGAAACCATAAAAATATTTGAAGAACAGTGCC
AGACCCAAGAGCGGTACAGCAAAGTATACATATGAAAGTTTAAACGTGGAGGCAATGAGA
AAGAATACACAGATTATGCATAATTATGATAAGTTGAAGTCTCGCATCAGTGAAATTATG
ACAGTAGAG
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_181504
ORF Size 1365 bp
Insert Size 2800
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_181504.2, NP_852556
RefSeq Size 5663
Locus ID 5295
Cytogenetics 5q13.1
Protein Families Druggable Genome
Protein Pathways ErbB signaling pathway, Chemokine signaling pathway, Phosphatidylinositol signaling system, mTOR signaling pathway, Apoptosis, VEGF signaling pathway, Focal adhesion, Toll-like receptor signaling pathway, Jak-STAT signaling pathway, Natural killer cell mediated cytotoxicity, T cell receptor signaling pathway, B cell receptor signaling pathway, Fc epsilon RI signaling pathway, Fc gamma R-mediated phagocytosis, Leukocyte transendothelial migration, Neurotrophin signaling pathway, Regulation of actin cytoskeleton, Insulin signaling pathway, Progesterone-mediated oocyte maturation, Type II diabetes mellitus, Pathways in cancer, Colorectal cancer, Renal cell carcinoma, Pancreatic cancer, Endometrial cancer, Glioma, Prostate cancer, Melanoma, Chronic myeloid leukemia, Acute myeloid leukemia, Small cell lung cancer, Non-small cell lung cancer
Gene Summary Phosphatidylinositol 3-kinase phosphorylates the inositol ring of phosphatidylinositol at the 3-prime position. The enzyme comprises a 110 kD catalytic subunit and a regulatory subunit of either 85, 55, or 50 kD. This gene encodes the 85 kD regulatory subunit. Phosphatidylinositol 3-kinase plays an important role in the metabolic actions of insulin, and a mutation in this gene has been associated with insulin resistance. Alternative splicing of this gene results in four transcript variants encoding different isoforms. [provided by RefSeq, Jun 2011]
Transcript Variant: This variant (2) uses an alternate in-frame exon in the 5' coding region, compared to variant 1. The encoded isoform (2) has a distinct N-terminus, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.