Cyclin B1(CCNB1) (NM_031966) Human Untagged Clone

CAT#: SC106758

CCNB1 (untagged)-Human cyclin B1 (CCNB1)

USD 196.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Cyclin B1(CCNB1) (NM_031966) Human Untagged Clone
Symbol CCNB1
Synonyms CCNB
Vector pCMV6-XL4
Sequence Data
>OriGene ORF within SC106758 sequence for NM_031966 edited (data generated by NextGen Sequencing)
ATGGCGCTCCGAGTCACCAGGAACTCGAAAATTAATGCTGAAAATAAGGCGAAGATCAAC
ATGGCAGGCGCAAAGCGCGTTCCTACGGCCCCTGCTGCAACCTCCAAGCCCGGACTGAGG
CCAAGAACAGCTCTTGGGGACATTGGTAACAAAGTCAGTGAACAACTGCAGGCCAAAATG
CCTATGAAGAAGGAAGCAAAACCTTCAGCTACTGGAAAAGTCATTGATAAAAAACTACCA
AAACCTCTTGAAAAGGTACCTATGCTGGTGCCAGTGCCAGTGTCTGAGCCAGTGCCAGAG
CCAGAACCTGAGCCAGAACCTGAGCCTGTTAAAGAAGAAAAACTTTCGCCTGAGCCTATT
TTGGTTGATACTGCCTCTCCAAGCCCAATGGAAACATCTGGATGTGCCCCTGCAGAAGAA
GACCTGTGTCAGGCTTTCTCTGATGTAATTCTTGCAGTAAATGATGTGGATGCAGAAGAT
GGAGCTGATCCAAACCTTTGTAGTGAATATGTGAAAGATATTTATGCTTATCTGAGACAA
CTTGAGGAAGAGCAAGCAGTCAGACCAAAATACCTACTGGGTCGGGAAGTCACTGGAAAC
ATGAGAGCCATCCTAATTGACTGGCTAGTACAGGTTCAAATGAAATTCAGGTTGTTGCAG
GAGACCATGTACATGACTGTCTCCATTATTGATCGGTTCATGCAGAATAATTGTGTGCCC
AAGAAGATGCTGCAGCTGGTTGGTGTCACTGCCATGTTTATTGCAAGCAAATATGAAGAA
ATGTACCCTCCAGAAATTGGTGACTTTGCTTTTGTGACTGACAACACTTATACTAAGCAC
CAAATCAGACAGATGGAAATGAAGATTCTAAGAGCTTTAAACTTTGGTCTGGGTCGGCCT
CTACCTTTGCACTTCCTTCGGAGAGCATCTAAGATTGGAGAGGTTGATGTCGAGCAACAT
ACTTTGGCCAAATACCTGATGGAACTAACTATGTTGGACTATGACATGGTGCACTTTCCT
CCTTCTCAAATTGCAGCAGGAGCTTTTTGCTTAGCACTGAAAATTCTGGATAATGGTGAA
TGGACACCAACTCTACAACATTACCTGTCATATACTGAAGAATCTCTTCTTCCAGTTATG
CAGCACCTGGCTAAGAATGTAGTCATGGTAAATCAAGGACTTACAAAGCACATGACTGTC
AAGAACAAGTATGCCACATCGAAGCATGCTAAGATCAGCACTCTACCACAGCTGAATTCT
GCACTAGTTCAAGATTTAGCCAAGGCTGTGGCAAAGGTGTAA

Clone variation with respect to NM_031966.2
>OriGene 5' read for NM_031966 unedited
CAGATTTGTATACGACNACTATAGGCGGCACGCGAATTCGCACGAGTTGGTTTCTGCTGG
GTGTAAGTCCTTGGCTGGTCGGGCCTCCGGTGTTCTGCTTCTCCCCGCTGAGCTGCTGCC
TGGTGAATAGGAAGCCATGGCGCTCCGAGTCACCAGGAACTCGAAAATTAATGCCTGAAA
ATAAGGCGAAGATCAACATGGCAGGCGCAAAGCGCGTTCCTACGGCCCCTGCTGCAACCT
CCAAGCCCGGACTGAGGCCAAGAACAGCTCTTGGGGACATTGGTAACAAAGTCAGTGAAC
AACTGCAGGCCAAAATGCCTATGAAGAAAGAAGCAAAACCTTCAGCTACTGGAAAAGTCA
TTGATAAAAAACTACCAAAACCTCTTGAAAAGGTACCTATGCTGGTGCCAGTGCCAGTGT
CTGATCCAGTGCCAGATCCAGAACCTGAGCCAGAACCTGAGCCTGTTAAAGAAGAAAAAC
TTTCGCCTGAGCCTATTTTGGTTGATACTGCCTCTCCAAGCCCAATGGAAACATCTGGAT
GTGCCCCTGCAGAAGAAGACCTGTGTCAAGCTTTCTCTGATGTAATTCTTGCAGTAAATG
ATGTGGATGCAGAAGATGGAGCTGATCCAAACCTTTGTAGAGAATATGTGAAAGATATTT
ATGCTTATCTGAGACAACTTGAGGAAGATCAAGCAGTCAGACCAAAATACCTACTGGGTC
GGGAAGTCACTGGATACATGAGAGCCATCCTAATTGACTGGCTAGTACAGGTTCAAATGA
AATTCAAGTTGTTGCAAGAGACCATGTACATGACTGTCTNCTTATAGATCGGTTCATGCA
GAATAATTGTGTGCCCATAATAGCTGCAGCTGGNTANAGTCACTGCATGTTTATTGCATG
CAATATGAGATATGTCCCTNCANAATAGAGACTTGCTTTTGTGACGACACACTGTACTAT
GCACAATCAGAAGAG
>OriGene 3' read for NM_031966 unedited
NGGGGAATTACTGTGNNACCGCGGCCGCTTNCTAGNGATCGGTTTTTTTTTTTTTTTTTT
TTTTTTTTTTTTTTTTTTTTTTTTTTCACAGATGGCACATGGGGCCAATTTTATTTGGAA
ATATAGTACTCCAACTCAAGTTTACAAGTTACACCTTTGCCACAGCCTTGGCTAAATCTT
GAACTAGTGCAAAATTCAGCTGGGGTAGAGGGCTGATCTTAGCATGCTTCGATGGGGCAT
ACTTGTTCTTGACAGTCATGTGCTTTGTAAGTCCTTGATTTACCATGACTACATTCTTAG
CCAGGTGCTGCATAACTGGAAAAAAAAATTCTTCAGTATATGACAGGTAATGTTGTAAAG
TTGGTGTCCATTCACCATTATCCAGAATTTTCAGTGCTAAGCAAAAAGCTCCTGCTGCAA
TTTGAGAAGGAGGAAAGTGCACCATGTCATAGTCCAACATAGTTAGTTCCATCAGGTATT
TGGCCAAAGTATGTTGCTCGACATCAACCTCTCCAATCTTAGATGCTCTCCGAAGGAAGT
GCAAAGGTAGAGGCCGACCCAGACCAAAGTTTAAAGCTCTTAGAATCTTCATTTCCATCT
GTCTGATTTGGTGCTTAGTATAAGTGTTGGCAGTCACAAAAGCAAAGTCACCAATTTCTG
GAGGGTACATTTCTTCAATATTGCTTGGCATAAACATGGCAGTGACACCCAACAGCTGCA
GCATCTTTTTGGGCACACAATTATTCTGGATGAACCGATCAATAATGGAGAACAGTCTGT
ACATGGTCTCCTGCAACAACCTGGAATTTCATTTTGACCCTGGCCTAGCCAGTCCATTAA
GATGGCTCTCATGGTTCCAGGGCCTTCCGGACCCAAAGGGATTTTGGCCTGACGG
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_031966
ORF Size 1302 bp
Insert Size 1500
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_031966.2, NP_114172
RefSeq Size 2101
RefSeq ORF 1302
Locus ID 891
Cytogenetics 5q13.2
Domains cyclin_C, CYCLIN, cyclin
Protein Families Stem cell - Pluripotency, Druggable Genome
Protein Pathways Cell cycle, Oocyte meiosis, p53 signaling pathway, Progesterone-mediated oocyte maturation
Gene Summary The protein encoded by this gene is a regulatory protein involved in mitosis. The gene product complexes with p34(cdc2) to form the maturation-promoting factor (MPF). Two alternative transcripts have been found, a constitutively expressed transcript and a cell cycle-regulated transcript, that is expressed predominantly during G2/M phase. The different transcripts result from the use of alternate transcription initiation sites. [provided by RefSeq, Jul 2008]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.