GAPDH (XM_088619) Human Untagged Clone

CAT#: SC106718

(untagged)-Human similar to glyceraldehyde-3-phosphate dehydrogenase (LOC158611) mRNA

USD 618


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name GAPDH (XM_088619) Human Untagged Clone
Symbol GAPDH
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for XM_088619, the custom clone sequence may differ by one or more nucleotides


ATGTTTGTCATGGGTGTGAACCATGAGAAGTATGACAACAACCTCAAGATTGTCGGCAGTGCCTTCTGCA
CCACCAACTGCTTAGCACCCCTGGCCAAGGTCATCCATGACAACTTTGGTATCGTGGAAGGACTCATGAC
CATAGTCCACGCCATCACTGCCACCCAGAAGACTGTGGATGGCCCCTCCGGGAAACTGTGGCGTGATGGC
CACGGGGCTCTCCAGAACATCATCCCTGCCTCTACTGGCACTGCGAAGGCTATGGGCAAGGTCATCCCTG
AGCTGAACGGGAAGCTCACTGGCATGGCCTTCTGTGTCCCCACTGCCGTGTCAGTGGTGGACCTGACCTG
CCGTCTGGAAAAACCTGCCAAATATGATGACACCAAGAAGGTGGTGAAGCAGGCATCGGAGGGCCCCCTC
AAGGGCATCCTGGGCTACACTGAGCACCAGGTGGTCTCCTCCGACTTCAACAGCAACACCCACTCTTCCA
CCTTCAATGCTGGGGCTGTCATTGCCCTCAACAACCACTTTTTCAAGCTCATTTCCTGGTATGACAATGA
ATTTGGCTACAGCAACAGGATGGTGGACCTCATGGCCCACATGGCCTCCAAGGAGTAA


5' Read Nucleotide Sequence
>OriGene 5' read for XM_088619 unedited
GGGGGTTCAGATTTGTATACGACTCATATAGGCGGCCGCGNAATTCGCACGAGGCGACAG
TCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGCCACATCGCTGAGACACCATGGGGAAG
GTGAAGGTCGGAGTCAACGGATTTGGTCGTATTGGGCGCCTGGTCACCAGGGCTGCTTTT
AACTCTGGTAAAGTGGATATTGTTGCCATCAATGACCCCTTCATTGACCTCAACTACATG
GTTTACATGTTCCAATATGATTCCACCCATGGCAAATTCCATGGCACCGTCAAGGCTGAG
AACGGGAAGCTTGTCATCAATGGAAATCCCATCACCATCTTCCAGGAGCGAGATCCCTCC
AAAATCAAGTGGGGCGATGCTGGCGCTGAGTACGTCGTGGAGTCCACTGGCGTCTTCACC
ACCATGGAGAAGGCTGGGGCTCATTTGCAGGGGGGAGCCAAAAGGGTCATCATCTCTGCC
CCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTGAACCATGAGAAGTATGACAACAGC
CTCAAGATCATCAGCAATGCCTCCTGCACCACCAACTGCTTAGCACCCCTGGCCAAGGTC
ATCCATGACAACTTTGGTATCGTGGAAGGACTCATGACCACAGTCCATGCCATCACTGCC
ACCCAGAAGACTGTGGATGGCCCCTCCGGGAAACTGTGGCGTGATGGCCGCGGNGCTCTC
CAGAACATCATCCCTGCCTCTACTGGCGCTGCCAAGGCTGTGGGCAAGGTCATCCCTGAG
CTGAACGGGAAGCTCACTGGCATGGCCTTNCGTGTCCCNCACTGCCACGTGTCAGTGGTG
GACCTGACCTGNCGTCTAGAAAACCTGCCAATATGATGACAC
3' Read Nucleotide Sequence
>OriGene 3' read for XM_088619 unedited
GCCAGGGTACTTTCATTGTGGTACATGACAGGTGCGGCTCCCTAGGCCCCTCCCCTCTTC
AAGGGGGTCTACATGGNAAACTGTGAGGAGGGGAGATTCAGTGTGGTGGGGGACTGAGTG
TGGCAGGGACTCCCCAGCAGTGAGGGTCTCTCTCTTCCTCTTGTGCTCTTGCTGGGGCTG
GTGGTCCAGGGGTCTTACTCCTTGGAGGCCATGTGGGCCATGAGGTCCACCACCCTGTTG
CTGTAGCCAAATTCGTTGTCATACCAGGAAATGAGCTTGACAAAGTGGTCGTTGAGGGCA
ATGCCAGCCCCAGCGTCGAAGGTGGAGGAGTGGGTGTCGCTGTTGAAGTCAGAGGAGACC
ACCTGGTGCTCAGTGTAGCCCAGGATGCCCTTGAGGGGGCCCTCCGACGCCTGCTTCACC
ACCTTCTTGATGTCATCATATTTGGCAGGTTTTTCTAGACGGCAGGTCAGGTCCACCACT
GACACGTTGGCAGTGGGGACACGGAAGGCCATGCCAGTGAGCTTCCCGTTCAGCTCAGGG
ATGACCTTGCCCACAGCCTTGGCAGCGCCAGTAGAGGCAGGGATGATGTTCTGGAGAGCC
CCGCGGCCATCACGCCACAGTTTCCCGGAGGGGCCATCCACAGTCTTCTGGGTGGCAGTG
ATGGCATGGACTGTGGTCATGAGTCCTTCCACGATACCAAAGTTGTCATGGATGACCTTG
GCCAGGGGTGCTANAGCAGTGGTGGTGCAGGAGGCATTGCTGATGATCTTGAGGCTGGTG
TCATACTTCTCATGGTTCACACCCATGACGAACATGGNGGGCGTCAGCANAGGGGGCANA
GATGATGACCCTTTTGGCTCCCCCCTGCAATGAGCCCCAGCCTCTTCATGGGTGGTGAAG
ACGCCAGTGGACTNCACGACGTACTCAGCGCAGCATGGCCCCACTGATTTTGGAAGAATC
TCGCTCTGGAAAATGGGGAGGGGATTCCATGATGACAAGCA
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN XM_088619
ORF Size 483 bp
Insert Size 1470
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq Size 1280
RefSeq ORF 483
Locus ID 2597
Cytogenetics 12p13.31
Domains gpdh_C
Protein Families ES Cell Differentiation/IPS
Protein Pathways Glycolysis / Gluconeogenesis, Metabolic pathways, Alzheimer's disease
Gene Summary This gene encodes a member of the glyceraldehyde-3-phosphate dehydrogenase protein family. The encoded protein has been identified as a moonlighting protein based on its ability to perform mechanistically distinct functions. The product of this gene catalyzes an important energy-yielding step in carbohydrate metabolism, the reversible oxidative phosphorylation of glyceraldehyde-3-phosphate in the presence of inorganic phosphate and nicotinamide adenine dinucleotide (NAD). The encoded protein has additionally been identified to have uracil DNA glycosylase activity in the nucleus. Also, this protein contains a peptide that has antimicrobial activity against E. coli, P. aeruginosa, and C. albicans. Studies of a similar protein in mouse have assigned a variety of additional functions including nitrosylation of nuclear proteins, the regulation of mRNA stability, and acting as a transferrin receptor on the cell surface of macrophage. Many pseudogenes similar to this locus are present in the human genome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.