14 3 3 gamma(YWHAG) (XM_050409) Human Untagged Clone

CAT#: SC106710

(untagged)-Human tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein gamma polypeptide (YWHAG) mRNA

USD 196.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name 14 3 3 gamma(YWHAG) (XM_050409) Human Untagged Clone
Symbol YWHAG
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC106710 sequence for XM_050409 edited (data generated by NextGen Sequencing)
ATGGTGGACCGCGAGCAACTGGTGCAGAAAGCCCGGCTGGCCGAGCAGGCGGAGCGCTAC
GACGACATGGCCGCGGCCATGAAGAACGTGACAGAGCTGAATGAGCCACTGTCGAATGAG
GAACGAAACCTTCTGTCTGTGGCCTACAAGAACGTTGTGGGGGCACGCCGCTCTTCCTGG
AGGGTCATCAGTAGCATTGAGCAGAAGACATCTGCAGACGGCAATGAGAAGAAGATTGAG
ATGGTCCGTGCGTACCGGGAGAAGATAGAGAAGGAGTTGGAGGCTGTGTGCCAGGATGTG
CTGAGCCTGCTGGATAACTACCTGATCAAGAATTGCAGCGAGACCCAGTACGAGAGCAAA
GTGTTCTACCTGAAGATGAAAGGGGACTACTACCGCTACCTGGCTGAAGTGGCCACCGGA
GAGAAAAGGGCGACGGTGGTGGAGTCCTCCGAGAAGGCCTACAGCGAAGCCCACGAGATC
AGCAAAGAGCACATGCAGCCCACCCACCCCATCCGATTAGGCCTGGCTCTTAACTACTCC
GTCTTCTACTATGAGATCCAGAACGCCCCAGAGCAAGCGTGCCACTTGGCCAAGACCGCG
TTCGACGACGCCATCGCCGAGCTTGACACCCTCAACGAGGACTCCTACAAGGACTCCACG
CTCATCATGCAGCTCCTCCGCGACAACCTCACGCTCTGGACGAGCGACCAGCAGGACGAC
GATGGCGGCGAAGGCAACAATTAA

Clone variation with respect to XM_050409.1
5' Read Nucleotide Sequence
>OriGene 5' read for XM_050409 unedited
TGTAATACGACTCACTATAGGGCGGCCGCGAATTCGGCACGAGGCCGCGCAGCCGCCGCC
TCAGCTGCTCGCTCTGTGGGTCGGTCCTCTCCGGCACTTGGGCTCCAGTCGCGCCCTCCA
AGCCCTTCAGGCCGCCCCAGTGTCCTCCTCCTTCTCCGGCCAGACCCAGCCCCGCGAAGA
TGGTGGACCGCGAGCAACTGGTGCAGAAAGCCCGGCTGGCCGAGCAGGCGGAGCGCTACG
ACGACATGGCCGCGGCCATGAAGAACGTGACAGAGCTGAATGAGCCACTGTCGAATGAGG
AACGAAACCTTCTGTCTGTGGCCTACAAGAACGTTGTGGGGGCACGCCGCTCTTCCTGGA
GGGTCATCAGTAGCATTGAGCAGAAGACATCTGCAGACGGCAATGAGAAGAAGATTGAGA
TGGTCCGTGCGTACCGGGAGAAGATAGAGAAGGAGTTGGAGGCTGTGTGCCAGGATGTGC
TGAGCCTGCTGGATAACTACCTGATCAAGAATTGCAGCGAGACCCAGTACGAGAGCAAAG
TGTTCTACCTGAAGATGAAAGGGGACTACTACCGCTACCTGGCTGAAGTGGCCACCGGAG
AGAAAAGGGCGACGGTGGTGGAGTCCTCCGAGAAGGCCTACAGCGAAGCCCACGAGATCA
GCAAAGAGCACATGCAGCCCACCCACCCCATCCGATTAGGCCTGGCTCTTAACTACTCCG
TCTTCACTATGAGATCCAGAACGCCCCNAGAGCAGCGTGCCACTTGGCCAAGACGCGTTC
GACGACGCCATCGCCGAGCTTGACACCCTCACGAGGACTNCTACAGGGACTNCACGCTCA
TCATGCAGNNTCTCCGCGACACCTCACGCTCTGGACGAGCGACANCAGGACGACGATGGC
GGCGAAGGGCACATTAGGCCCNANGGAACTGCCACA
3' Read Nucleotide Sequence
>OriGene 3' read for XM_050409 unedited
CGCGGGCCGCAATCTAGAATCGAGTTTTTTTTTTTTTTTTTTCCTGGCGTCAGATCTGTA
AGTTTATTTGCTCAATGTACGACAGCTACATAATGACTCACATTCATGATATTCCATCAC
TGAGGAAACTGCTAAAGATGGTCCGTGTGTGAAATAATTCCTTAGAGAAACACGGAGCTG
GAAAAATAATCACTGATTAGACCTTAAAAATAGTTCACTGCATAACATGACAAAAAGCAC
AAAGGCTCATTCAGAGAACATATTTGTTGTTCTCCAACACTGTAATAGTTATAATTTCAC
CATGACAAACACCAGACATTAAGATTAAGCTAACACTGGTGTTTCTTTTGCTCCCCCCCT
TTTAAAAACAAAATATATAACTGCATGTCACTATAGCAACATCCAAAACAGATCAATTTG
TTACAATCACTATTTGGTAGAGCAAACTTTACCCCCAAAAGGAAAAATTAAATTAAAAAA
AAAACCTTTAAAAAATTTGAAGACTTAATTTTTTTTGTCATAGGAATACATAACACCTAC
AGTATAAGTTAATCAATTTCAAGCTACTGTATAGAAATACAACACTAGCATGCACAATAT
TGTATCAATAGAGTAATGGAGGAGTAATCATTTCACTGGAGAGACAGTATCATAGGCAAG
TGCATTTCTTTAAAATAAAGAAAAGAANAACCATTCAAGCTGCTTAAATATCAAGTCTCC
CATTCCCTCTCCCGTTTCAGCCCTCAGGTGTGATTTTTATCTTGCATTATTCTAANAAGC
AGCCAGAGCCAAAAGCTGAATTTAAAGGAAAAATAGGTTTTGTTATTCCAGTAAATCATT
TCCAAATGCTACAAGGAAAAACGCACACTGCTCACTGGACATGAGATAATAGGAAAGTCT
GCTGGGTAACTGGGCGAGTACAGACCCATGGGCTGGGACATCGGGGTCTCTACTTACTGG
ACCGT
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN XM_050409
ORF Size 3702 bp
Insert Size 3780
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq Size 3702
Locus ID 7532
Cytogenetics 7q11.23
Domains 14-3-3
Protein Families Druggable Genome
Protein Pathways Cell cycle, Oocyte meiosis, Neurotrophin signaling pathway
Gene Summary This gene product belongs to the 14-3-3 family of proteins which mediate signal transduction by binding to phosphoserine-containing proteins. This highly conserved protein family is found in both plants and mammals, and this protein is 100% identical to the rat ortholog. It is induced by growth factors in human vascular smooth muscle cells, and is also highly expressed in skeletal and heart muscles, suggesting an important role for this protein in muscle tissue. It has been shown to interact with RAF1 and protein kinase C, proteins involved in various signal transduction pathways. [provided by RefSeq, Jul 2008].
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.