RUNX1 (NM_001001890) Human Untagged Clone

CAT#: SC106348

RUNX1 (untagged)-Human runt-related transcription factor 1 (RUNX1), transcript variant 2

USD 721


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name RUNX1 (NM_001001890) Human Untagged Clone
Symbol RUNX1
Synonyms AML1; AML1-EVI-1; AMLCR1; CBFA2; EVI-1; PEBP2aB
Vector pCMV6-XL4
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_001001890 edited
TCATGCGTATCCCCGTAGATGCCAGCACGAGCCGCCGCTTCACGCCGCCTTCCACCGCGC
TGAGCCCAGGCAAGATGAGCGAGGCGTTGCCGCTGGGCGCCCCGGACGCCGGCGCTGCCC
TGGCCGGCAAGCTGAGGAGCGGCGACCGCAGCATGGTGGAGGTGCTGGCCGACCACCCGG
GCGAGCTGGTGCGCACCGACAGCCCCAACTTCCTCTGCTCCGTGCTGCCTACGCACTGGC
GCTGCAACAAGACCCTGCCCATCGCTTTCAAGGTGGTGGCCCTAGGGGATGTTCCAGATG
GCACTCTGGTCACTGTGATGGCTGGCAATGATGAAAACTACTCGGCTGAGCTGAGAAATG
CTACCGCAGCCATGAAGAACCAGGTTGCAAGATTTAATGACCTCAGGTTTGTCGGTCGAA
GTGGAAGAGGGAAAAGCTTCACTCTGACCATCACTGTCTTCACAAACCCACCGCAAGTCG
CCACCTACCACAGAGCCATCAAAATCACAGTGGATGGGCCCCGAGAACCTCGAAGACATC
GGCAGAAACTAGATGATCAGACCAAGCCCGGGAGCTTGTCCTTTTCCGAGCGGCTCAGTG
AACTGGAGCAGCTGCGGCGCACAGCCATGAGGGTCAGCCCACACCACCCAGCCCCCACGC
CCAACCCTCGTGCCTCCCTGAACCACTCCACTGCCTTTAACCCTCAGCCTCAGAGTCAGA
TGCAGGATACAAGGCAGATCCAACCATCCCCACCGTGGTCCTACGATCAGTCCTACCAAT
ACCTGGGATCCATTGCCTCTCCTTCTGTGCACCCAGCAACGCCCATTTCACCTGGACGTG
CCAGCGGCATGACAACCCTCTCTGCAGAACTTTCCAGTCGACTCTCAACGGCACCCGACC
TGACAGCGTTCAGCGACCCGCGCCAGTTCCCCGCGCTGCCCTCCATCTCCGACCCCCGCA
TGCACTATCCAGGCGCCTTCACCTACTCCCCGACGCCGGTCACCTCGGGCATCGGCATCG
GCATGTCGGCCATGGGCTCGGCCACGCGCTACCACACCTACCTGCCGCCGCCCTACCCCG
GCTCGTCGCAAGCGCAGGGAGGCCCGTTCCAAGCCAGCTCGCCCTCCTACCACCTGTACT
ACGGCGCCTCGGCCGGCTCCTACCAGTTCTCCATGGTGGGCGGCGAGCGCTCGCCGCCGC
GCATCCTGCCGCCCTGCACCAACGCCTCCACCGGCTCCGCGCTGCTCAACCCCAGCCTCC
CGAACCAGAGCGACGTGGTGGAGGCCGAGGGCAGCCACAGCAACTCCCCCACCAACATGG
CGCCCTCCGCGCGCCTGGAGGAGGCCGTGTGGAGGCCCTACTGAGGCGCCAGGCCTGGCC
CGGCTGGGCCCCGCGGGCCGCCGCCTTCGCCTCCGGGCGCGCGGGCCTCCTGTTCGCGAC
AAGCCCGCCGGGATCCCGGGCCCTGGGCCCGGCCACCGTCCTGGGGCCGAGGGCGCCCGA
CGGCCAGGATCTCGCTGTAGGTCAGGCCCGCGCAGCCTCCTGCGCCCAGAAGCCCACGCC
GCCGCCGTCTGCTGGCGCCCCGGCCCTCGCGGAGGTGTCCGAGGCGACGCACCTCGAGGG
TGTCCGCCGGCCCCAGCACCCAGGGGACGCGCTGGAAAGCAAACAGGAAGATTCCCGGAG
GGAAACTGTGAATGCTTCTGATTTAGCAATGCTGTGAATAAAAAGAAAGATTTTATACCC
TTGAAAAAAAAAAAAAAAAAA
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_001001890
ORF Size 1362 bp
Insert Size 1700
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_001001890.1.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001001890.1, NP_001001890
RefSeq Size 7288
RefSeq ORF 1362
Locus ID 861
Cytogenetics 21q22.12
Protein Families ES Cell Differentiation/IPS, Transcription Factors, Druggable Genome
Protein Pathways Pathways in cancer, Chronic myeloid leukemia, Acute myeloid leukemia
Gene Summary Core binding factor (CBF) is a heterodimeric transcription factor that binds to the core element of many enhancers and promoters. The protein encoded by this gene represents the alpha subunit of CBF and is thought to be involved in the development of normal hematopoiesis. Chromosomal translocations involving this gene are well-documented and have been associated with several types of leukemia. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) differs in the 5' UTR and coding region compared to variant 1. The resulting isoform (AML1b) is shorter and has a distinct N-terminus compared to isoform AML1c.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations