HLA (BC008403) Human Untagged Clone

CAT#: SC106319

HLA (untagged)-Homo sapiens, Similar to major histocompatibility complex, class II, DR beta 5, clone MGC:14522 IMAGE:4272571, complete cds

USD 196.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name HLA (BC008403) Human Untagged Clone
Symbol HLA
Synonyms HLA-DR1B
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC106319 sequence for BC008403 edited (data generated by NextGen Sequencing)
ATGGTGTGTCTGAGGCTCCCTGGAGGCTCCTGCATGGCAGTTCTGACAGTGACACTGATG
GTGCTGAGCTCCCCACTGGCTTTGGCTGGGGACACCAGACCACGTTTCTTGGAGTACTCT
ACGTCTGAGTGTCATTTCTTCAATGGGACGGAGCGGGTGCGGTTCCTGGACAGATACTTC
TATAACCAAGAGGAGTACGTGCGCTTCGACAGCGACGTGGGGGAGTTCCGGGCGGTGACG
GAGCTGGGGCGGCCTNNNNNNGAGTACTGGAACAGCCAGAAGGACATCCTGGAAGACGAG
CGGGCCGCGGTGGACACCTACTGCAGACACAACTACGGGGTTGNNNAGAGCTTCACAGTG
CAGCGGCGAGTCCATCCTAAGGTGACTGTGTATCCTTCAAAGACCCAGCCCCTGCAGCAC
CACAACCTCCTGGTCTGTTCTGTGAGTGGTTTCTATCCAGGCAGCATTGAAGTCAGGTGG
TTCCGGAATGGCCAGGAAGAGAAGACTGGGGTGGTGTCCACAGGCCTGATCCACAATGGA
GACTGGACCTTCCAGACCCTGGTGATGCTGGAAACAGTTCCTCGGAGTGGAGAGGTTTAC
ACCTGCCAAGTGGAGCACCCAAGCGTGACAAGCCCTCTCACAGTGGAATGGAGAGCACGG
TCTGAATCTGCACAGAGCAAGATGCTGAGTGGAGTCGGGGGCTTTGTGCTGGGCCTGCTC
TTCCTTGGGGCCGGGCTGTTCATCTACTTCAGGAATCAGAAAGGACACTCTGGACTTCAG
CCAAGAGGATTCCTGAGCTGA

Clone variation with respect to BC008403.1
227 a=>t;256 a=>n;257 g=>n;258 c=>n;259 g=>n;260 c=>n;261 c=>n;298 a=>g;344 g=>n;345 t=>n;346 g=>n;357 g=>a
5' Read Nucleotide Sequence
>OriGene 5' read for BC008403 unedited
AGGAATTTGTAATACGACTCACTTATAGGGCGGCCGCGATTCGGCACGAGGCTTGCCTGC
TGCTCTGGCCCCTGGTCCTGTCCTGTTCTCCAGCATGGTGTGTCTGAGGCTCCCTGGAGG
CTCCTGCATGGCAGTTCTGACAGTGACACTGATGGTGCTGAGCTCCCCACTGGCTTTGGC
TGGGGACACCAGACCACGTTTCTTGGAGTACTCTACGTCTGAGTGTCATTTCTTCAATGG
GACGGAGCGGGTGCGGTTCCTGGACAGATACTTCTATAACCAAGAGGAGTACGTGCGCTT
CGACAGCGACGTGGGGGAGTTCCGGGCGGTGACGGAGCTGGGGCGGCCTGATGAGGAGTA
CTGGAACAGCCAGAAGGACATCCTGGAAGACGAGCGGGCCGCGGTGGACACCTACTGCAG
ACACAACTACGGGGTTGTGGAGAGCTTCACAGTGCAGCGGCGAGTCCATCCTAAGGTGAC
TGTGTATCCTTCAAAGACCCAGCCCCTGCAGCACCACAACCTCCTGGTCTGTTCTGTGAG
TGGTTTCTATCCAGGCAGCATTGAAGTCAGGTGGTTCCGGAATGGCCAGGAAGAGAAGAA
CTGGGTGGTGTCCACAGGCCTGATCCACAATGGAGACTGGACCTTCCAGACCCTGGTGAT
GCTGGAAACAGTTCCTCGGAGTGGAGAGGTTTACACCTGCCAAGTGGAGCACCCAAGCGT
GACAAGCCCTCTCACAGTGGAATGGAGAGCACGGGTCTGATCTGCACNAGCAAGTGCTGA
GTGGAGTCGGGGGCTTTGTGCTGGGCCTGCTCTTCCTTGGGCCNGGGCTGTTCATCTACT
TCAGGATCAGAAAGGACACTCTGNACTTCANCCCAGAGGATTCCTGANCTGAN
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN BC008403
ORF Size 801 bp
Insert Size 1000
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq BC008403.1, AAH08403
RefSeq Size 1202
Locus ID 3123
Cytogenetics 6p21.32
Domains MHC_II_beta, ig, IGc1
Protein Families Transmembrane
Protein Pathways Cell adhesion molecules (CAMs), Antigen processing and presentation, Hematopoietic cell lineage, Type I diabetes mellitus, Asthma, Autoimmune thyroid disease, Systemic lupus erythematosus, Allograft rejection, Graft-versus-host disease, Viral myocarditis
Gene Summary Binds peptides derived from antigens that access the endocytic route of antigen presenting cells (APC) and presents them on the cell surface for recognition by the CD4 T-cells. The peptide binding cleft accommodates peptides of 10-30 residues. The peptides presented by MHC class II molecules are generated mostly by degradation of proteins that access the endocytic route, where they are processed by lysosomal proteases and other hydrolases. Exogenous antigens that have been endocytosed by the APC are thus readily available for presentation via MHC II molecules, and for this reason this antigen presentation pathway is usually referred to as exogenous. As membrane proteins on their way to degradation in lysosomes as part of their normal turn-over are also contained in the endosomal/lysosomal compartments, exogenous antigens must compete with those derived from endogenous components. Autophagy is also a source of endogenous peptides, autophagosomes constitutively fuse with MHC class II loading compartments. In addition to APCs, other cells of the gastrointestinal tract, such as epithelial cells, express MHC class II molecules and CD74 and act as APCs, which is an unusual trait of the GI tract. To produce a MHC class II molecule that presents an antigen, three MHC class II molecules (heterodimers of an alpha and a beta chain) associate with a CD74 trimer in the ER to form a heterononamer. Soon after the entry of this complex into the endosomal/lysosomal system where antigen processing occurs, CD74 undergoes a sequential degradation by various proteases, including CTSS and CTSL, leaving a small fragment termed CLIP (class-II-associated invariant chain peptide). The removal of CLIP is facilitated by HLA-DM via direct binding to the alpha-beta-CLIP complex so that CLIP is released. HLA-DM stabilizes MHC class II molecules until primary high affinity antigenic peptides are bound. The MHC II molecule bound to a peptide is then transported to the cell membrane surface. In B-ce [UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.