Cytochrome P450 2C9(CYP2C9) (BC020754) Human Untagged Clone

CAT#: SC106226

CYP2C9 (untagged)-Homo sapiens, Similar to cytochrome P450, subfamily IIC (mephenytoin 4-hydroxylase), polypeptide 9, clone MGC:22601 IMAGE:4766890, complete cds

USD 618


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Cytochrome P450 2C9(CYP2C9) (BC020754) Human Untagged Clone
Symbol CYP2C9
Synonyms P450IIC9;CPC9; CYP2C; CYP2C10; MGC149605; MGC88320; OTTHUMP00000020135; cytochrome P-450 S-mephenytoin 4-hydroxylase; cytochrome P450, subfamily IIC (mephenytoin 4-hydroxylase), polypeptide 10; cytochrome P450, subfamily IIC (mephenytoin 4-hydroxylase),
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>OriGene sequence for BC020754 edited
TTCAATGGATTCTCTTGTGGTCCTTGTGCTCTGTCTCTCATGTTTGCTTCTCCTTTCACT
CTGGAGACAGAGCTCTGGGAGAGGAAAACTCCCTCCTGGCCCCACTCCTCTCCCAGTGAT
TGGAAATATCCTACAGATAGGTATTAAGGACATCAGCAAATCCTTAACCAATCTCTCAAA
GGTCTATGGCCCTGTGTTCACTCTGTATTTTGGCCTGAAACCCATAGTGGTGCTGCATGG
ATATGAAGCAGTGAAGGAAGCCCTGATTGATCTTGGAGAGGAGTTTTCTGGAAGAGGCAT
TTTCCCACTGGCTGAAAGAGCTAACAGAGGATTTGGAATTGTTTTCAGCAATGGAAAGAA
ATGGAAGGAGATCCGGCGTTTCTCCCTCATGACGCTGCGGAATTTTGGGATGGGGAAGAG
GAGCATTGAGGACCGTGTTCAAGAGGAAGCCCGCTGCCTTGTGGAGGAGTTGAGAAAAAC
CAAGGGTGGGTGA
Tag Tag Free
ACCN BC020754
ORF Size 489 bp
Insert Size 500
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to BC020754.1.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq BC020754.1, AAH20754
RefSeq Size 1459
RefSeq ORF 489
Locus ID 1559
Cytogenetics 10q23.33
Protein Families P450, Druggable Genome
Protein Pathways Arachidonic acid metabolism, Linoleic acid metabolism, Retinol metabolism, Metabolism of xenobiotics by cytochrome P450, Drug metabolism - cytochrome P450, Metabolic pathways
Gene Summary This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum and its expression is induced by rifampin. The enzyme is known to metabolize many xenobiotics, including phenytoin, tolbutamide, ibuprofen and S-warfarin. Studies identifying individuals who are poor metabolizers of phenytoin and tolbutamide suggest that this gene is polymorphic. The gene is located within a cluster of cytochrome P450 genes on chromosome 10q24. [provided by RefSeq, Jul 2008].
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.