TAT (BC020707) Human Untagged Clone

CAT#: SC106218

Reviews ()
Write a review

TAT (untagged)-Homo sapiens, Similar to tyrosine aminotransferase, clone MGC:22474 IMAGE:4710626, complete cds



USD 748.00


Availability*
In Stock

Size
    • 10 ug


Product images

Specifications

Product Data
Product Name TAT (BC020707) Human Untagged Clone
Type Human Untagged Clone
Tag Tag Free
Symbol TAT
Synonyms tyrosine aminotransferase; tyrosine aminotransferase, cytosolic
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Cell Selection None
Sequence Data
>NCBI ORF sequence for BC020707, the custom clone sequence may differ by one or more nucleotides


ATGGACCCATACATGATTCAGATGAGCAGCAAAGGCAACCTCCCCTCAATTCTGGACGTGCATGTCAACG
TTGGTGGGAGAAGCTCTGTGCCGGGAAAAATGAAAGGCAGAAAGGCCAGGTGGTCTGTGAGGCCCTCAGA
CATGGCCAAGAAAACTTTCAACCCCATCCGAGCCATTGTGGACAACATGAAGGTGAAACCAAATCCAAAC
AAAACCATGATTTCCCTGTCCATTGGTGAGTTGGGGACACTACTGAGGGGCTGTCATTGTCCTCCTCTAC
TCTCATGTTCACAGGCTGGTTGGAGAAGATGGCAGTTGGGGGTGAGTCTGAGTACTGAACATGGGAGAAT
AACCTCTTGGCTCCTTTTGTGTTTTCCTCCCATAAAAAGGGGACCCTACTGTGTTTGGAAACCTGCCTAC
AGACCCTGA


>OriGene 5' read for BC020707 unedited
GCGGTCACATTTGTATACGACTCACTATAGGGCGGCCGCGAATTCGCACGAGCAAANAAA
AGCTAAGGGAGCTTTCGGGGTTGGCTTCTTGGAGGCTGCTTTCTCCTTTACTTGGAAGGC
TTCGCTAGTGATGGACCCATACATGATTCAGATGAGCAGCAAAGGCAACCTCCCCTCAAT
TCTGGACGTGCATGTCAACGTTGGTGGGAGAAGCTCTGTGCCGGGAAAAATGAAAGGCAG
AAAGGCCAGGTGGTCTGTGAGGCCCTCAGACATGGCCAAGAAAACTTTCAACCCCATCCG
AGCCATTGTGGACAACATGAAGGTGAAACCAAATCCAAACAAAACCATGATTTCCCTGTC
CATTGGGGACCCTACTGTGTTTGGAAACCTGCCTACAGACCCTGAAGTTACCCAGGCAAT
GAAAGATGCCCTGGACTCGGGCAAATATAATGGCTATGCCCCATCCATCGGCTTCCTATC
CAGTCGGGAGGAGATTGCTTCTTATTACCACTGTCCTGAGGCACCCCTAGAAGCTAAGGA
CGTCATTCTGACAAGTGGCTGCAGCCAAGCTATTGACCTTTGTTTAGCTGTGTTGGCCAA
CCCAGGGCAAAACATCCTGGTTCCAAGACCTGGTTTCTCTCTCTACAAGACTCTGGCTGA
GTCTATGGGAATTGAGGTCAAACTCTACAATTTGTTGCCAGAGAAATCTTGNGAAATTGA
CCTGAACAACTGGAATATCTAATTGATGAAAAGACAGCTTGTCTCATTGTCAATAATCCA
TCAAACCCCTGTGGGTCAGTGTTCAGCAAACGTCATCTTCAGAAGATTCTGCAGTGGCTG
CACGGCAGTGTGTCCCCATCTTAGCTGATGAGATCTATGGAGACATGGTGTTTTTCNGAT
TTGCAATATGAAACACTGGCCAC
Restriction Sites NotI-NotI     
ACCN BC020707
Insert Size 4000 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq BC020707.1, AAH20707.1
RefSeq Size 1116 bp
RefSeq ORF 1116 bp
Locus ID 6898
Cytogenetics 16q22.2
Protein Families Druggable Genome, Embryonic stem cells, ES Cell Differentiation/IPS
Protein Pathways Cysteine and methionine metabolism, Metabolic pathways, Phenylalanine, tyrosine and tryptophan biosynthesis, Phenylalanine metabolism, Tyrosine metabolism, Ubiquinone and other terpenoid-quinone biosynthesis
Gene Summary This nuclear gene encodes a mitochondrial protein tyrosine aminotransferase which is present in the liver and catalyzes the conversion of L-tyrosine into p-hydroxyphenylpyruvate. Mutations in this gene cause tyrosinemia (type II, Richner-Hanhart syndrome), a disorder accompanied by major skin and corneal lesions, with possible cognitive disability. A regulator gene for tyrosine aminotransferase is X-linked. [provided by RefSeq, Jul 2008]
Frequently bought together (3)
TAT mouse monoclonal antibody,clone OTI3G6
    • 100 ul

USD 417.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 473.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 149.00

Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
Molbio tools