TOMM40L (NM_032174) Human Untagged Clone

CAT#: SC106147

TOMM40L (untagged)-Human translocase of outer mitochondrial membrane 40 homolog (yeast)-like (TOMM40L), nuclear gene encoding mitochondrial protein

USD 618.00


Availability*
4 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name TOMM40L (NM_032174) Human Untagged Clone
Symbol TOMM40L
Synonyms TOMM40B
Vector pCMV6-XL4
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_032174, the custom clone sequence may differ by one or more nucleotides


ATGGGGAACACATTGGGCCTGGCACCAATGGGGACTTTGCCCCGCCGGAGCCCCCGCCGAGAGGAACCCC
TGCCCAACCCTGGGAGCTTCGATGAGCTGCACCGTCTATGCAAAGATGTATTCCCAGCACAGATGGAGGG
AGTGAAGCTCGTTGTCAACAAGGTTCTGAGCAGCCATTTCCAGGTGGCGCACACTATACACATGAGTGCC
CTGGGCTTGCCGGGATATCACCTCCATGCGGCCTATGCAGGGGATTGGCAGCTCAGTCCCACTGAGGTGT
TCCCCACTGTGGTAGGGGATATGGACAGCAGTGGCAGCCTGAACGCCCAGGTCTTGCTCCTCTTGGCAGA
GCGGCTCCGAGCTAAGGCTGTCTTCCAGACGCAGCAGGCCAAGTTCCTGACATGGCAGTTTGATGGCGAG
TATCGGGGAGATGACTACACAGCCACTCTGACCCTAGGAAATCCTGACCTGATTGGGGAGTCGGTGATCA
TGGTTGCTCACTTCCTGCAGAGCCTCACTCATCGGCTGGTGCTGGGAGGAGAGCTAGTTTATCACCGGCG
GCCAGGCGAAGAGGGGGCCATCTTGACACTGGCTGGGAAGTACTCGGCTGTACACTGGGTAGCTACATTG
AATGTGGGATCAGGCGGGGCCCATGCAAGTTACTACCACAGGGCAAATGAACAGGTTCAGGTTGGAGTGG
AGTTTGAGGCAAACACAAGGCTACAAGACACAACATTCTCCTTTGGTTACCACCTGACTCTGCCCCAGGC
CAACATGGTATTTAGAGGCTTGGTGGATAGTAACTGGTGTGTAGGTGCTGTGCTGGAGAAGAAGATGCCC
CCTCTGCCTGTCACCCTAGCCCTTGGAGCCTTCCTCAATCACTGGCGCAACAGATTCCATTGTGGCTTCA
GCATCACTGTGGGCTGA


5' Read Nucleotide Sequence
>OriGene 5' read for NM_032174 unedited
GGAAGTTTCTGAGGCTGGGGAGCCGGATAATGGGGGGTGGGGCCCGTTGGGGGGTAAAGG
GGCAATAGCGTCCTTTCACAGGCTAACCTCGGCTCTTCCCAGTCCTCTGGACTAAAATGG
GGAACACATTGGGCCTGGCACCAATGGGGACTTTGCCCCGCCGGAGCCCCCGCCGAGAGG
AACCCCTGCCCAACCCTGGGAGCTTCGATGAGCTGCACCGTCTATGCAAAGATGTATTCC
CAGCACAGATGGAGGGAGTGAAGCTCGTTGTCAACAAAGTTCTGAGCAGCCATTTCCAGG
TGGCGCACACTATACACATGAGTGCCCTGGGCTTGCCGGGATATCACCTCCATGCGGCCT
ATGCAGGGGATTGGCAGCTCAGTCCCACTGAGGTGTTCCCCACTGTGGTANGGGATATGG
ACAGCAGTGGCAGCCTGAACGCCCAGGTCTTGCTCCTCTTGGCAGAGCGGCTCCGAGCTA
AGGCTGTCTTCCAGACGCAGCAGGCCAAGTTCCTGACATGGCAGTTTGATGGCGAGTATC
GGGGAGATGACTACACAGCCACTCTGACCCCTAGAAATCCTGACCTGGATTGGGAGTCGG
TGATCATGGTTGCTCACTTTCTGCAGAGCCTCACTCATCGGCTTGGTGCTGNGGAGGAGA
GCTAATTTATTCACCGGCGGNCANGCGAAGAGGGGGCCATCTTGAACCTGGCTGGAAATA
CTCGGCTGACACTGGGTACCTCCTTGGATGTGGGATCGGCGGGGCCAATGTCAGTACTAC
CACAGGCAATTGAACAGTTCAGTTTGGAGTGGAT
3' Read Nucleotide Sequence
>OriGene 3' read for NM_032174 unedited
CCCCGCNNAATCCTGAACCGCGNNCCGCATTCTANGATCGATTTTTTTTTTTTACTTTTT
TTTTTTTTTTTTTTTTTTATCCAGGACAGATGCAAAGTAGTAGCTCAGAAGGCTCTGGGT
AATAGCATTCCTGAGATTGATGACATCCATTACCTCACTAGTCCAACTTCTCCAGACTAA
CGCAGACTTTTCTCTTCCCTTGGCCTTTCCTCTCCTCGCCATTGGGCCAATTCCTTCGAT
TTCTCATTTCCCTTGAAGTTAGGGCCATTCACAGTTTCATGGCCAAAAGCCGGTCCCGGT
TCAAAAGCCTGGGATTTAACCCACGCTCTGAGGTATGCCCCGTTTTTGTTTCGCTCGTTC
CCCCCAAAACCCCCTTGGCCCAAAGGGGCCTGCCTCCTCCCTTTCCCCCCACCCCCCCTT
CCGTACCCCCGCCTCCAAGGTGCGGATCAGGCCCTCGCCCTCCCCGCTCCTCCCTCCCTC
ATTCGCCTCGCACCCCCTTCCCGCAGTCCCCGCCCCCCCTCATCATCAGCACCCCCCTGC
TGTGCTTCCCCCTCCCCCGTCGCCTTATTCCCCCGCCGCGCTCCCTCCCCCCCACCCTCC
CCCTCAGCTCGTTCCGCCCCGTCCCCCCCGACCGGCCCGACGACCCGCCCGCCCCTCCGT
CTCCCCCCCACCCTCCCCTGCATGCGTCCCTTCCCCTGCCACTCCCTCCCCCGTCTTCAC
CACTCCTCCCTCCGCGCGCTCTCCCGCCCACTCGATCCCCCCCTCGCTCTTCGGAGTCTC
GCTCTTCATCGCGCCCCCCACCCGACTCATCCAGTCCCGCGCATTTCTCCACACCCCCAC
GCTCTCCACGCTATTCACCGCCCGCCGCCGACCCATCTCATTTCCCTCCTCCCGCCCTCT
TGTTTATTCTTGAGACCCACCCCCCTCCCCCCCGCCCCGCCTCTTATCCTCCTCACCGCT
CCCCACCTAACTCAACGATCTCCGATTA
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_032174
ORF Size 927 bp
Insert Size 2800
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_032174.3, NP_115550
RefSeq Size 2927
Locus ID 84134
Cytogenetics 1q23.3
Domains Euk_porin
Protein Families Ion Channels: Other, Druggable Genome
Protein Pathways Amyotrophic lateral sclerosis (ALS)
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.