Eph receptor A4(EPHA4) (AF075040) Human Untagged Clone

CAT#: SC105885

(untagged)-Human full length insert cDNA YN63B03

USD 618


Availability*
2 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Eph receptor A4(EPHA4) (AF075040) Human Untagged Clone
Symbol EPHA4
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for AF075040, the custom clone sequence may differ by one or more nucleotides


TGCTATCTTGGCCTCACAGCCCTTCCTGTTGATTACAAAGCCCGTGGAAGAAAACAGAACACACCCTCCT
CAGTTCCGTCTAAATGTGTTTCTTCTGCTTCAATTACACCAGTTCTGGGGCAAAGACACTGATGAAACAA
CACCCATACCTGAAAAGAATAAATGTGTGACTTTCAAATCCCCTTTCGCAGTGAAAGAAACAGCAAACAC
TTAAGATTCAGCATCTGTTCTCCAGTTGCACTGAGGAATGCACTGTCTCGCAGCACCAGCTCTGCAGAGC
CCTTGCCCCAGACTCTTTGCGGTTTTATTTATATGTATTTCCATATTTCATTCCTGTGTGTCACTGCTGC
ATTGGTGTGGCAGCAAGTGACCAAATGCTACAGGTCTTACTATGGACACCAGGTCAGGTGCAACCACACA
AAACAAAGCCAGTTCCATGAGCTGCCTATGATATGCATTGCGGAAGTAACATTTTACCCAGGGTGTGCCA
TTGCAGTGATATAAATATATTTTTTTCTTAGACTAAAAAAAAAA


5' Read Nucleotide Sequence
>OriGene 5' read for AF075040 unedited
TACGACTCACTATAGGGCGGCCGCGAATTCGGCACGAGGCACACTTGTCCTAACTATCTT
GTGGATAGTGGGCTGTGACAATCTGGAATAGAGAACGTTCACACTTCGCTCCTTTAAAGA
AGCGACCCCAGATCTGCAAGGGAGTAGATTCTGCTATCTTGGCCTCACAGCCCTTCCTGT
TGATTACAAAGCCCGTGGAAGAAAACAGAACACACCCTCCTCAGTTCCGTCTAAATGTGT
TTCTTCTGCTTCAATTACACCAGTTCTGGGGCAAAGACACTGATGAAACAACACCCATAC
CTGAAAAGAATAAATGTGTGACTTTCAAATCCCCTTTCGCAGTGAAAGAAACAGCAAACA
CTTAAGATTCAGCATCTGTTCTCCAGTTGCACTGAGGAATGCACTGTCTCGCAGCACCAG
CTCTGCAGAGCCCTTGCCCCAGACTCTTTGCGGTTTTATTTATATGTATTTCCATATTTC
ATTCCTGTGTGTCACTGCTGCATTGGTGTGGCAGCAAGTGACCAAATGCTACAGGTCTTA
CTATGGACACCAGGTCAGGTGCAACCACACAAAACAAAGCCAGTTCCATGAGCTGCCTAT
GATATGCATTGCGGAAGTAACATTNTACCCANGGGTGTGCNCATTGCAGTGATATAAATA
TATTNTTTTCTTAGACTAAATATGAGCTGACTATCTCTTTTGATGTGTGTACATANNNGT
GTGAGTGTGTCTGTATGCGTGCCTGTCTGTGTGCCGGNTGTGTGTATGTGCGTANCCTCA
TGCTTANGACTACCCATGAATGTGTGGATGCTACACTNGNAGAGTTCTGGTTTNCCCCAG
TTNCAGATGGAAGACTACTGATACAGTGGACCTGGAGACCATCCCCTTGAANNGACACCC
NNAATGTTCAGCATCCTGGATCTACCCCTNCTGGATTTACACCGGTTTTTTGTANCTGTC
ACACTACCTTATAGAATTCTAGCN
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN AF075040
ORF Size 534 bp
Insert Size 2750
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq Size 534
RefSeq ORF 534
Locus ID 2043
Cytogenetics 2q36.1
Protein Families Protein Kinase, Transmembrane, Druggable Genome
Protein Pathways Axon guidance
Gene Summary This gene belongs to the ephrin receptor subfamily of the protein-tyrosine kinase family. EPH and EPH-related receptors have been implicated in mediating developmental events, particularly in the nervous system. Receptors in the EPH subfamily typically have a single kinase domain and an extracellular region containing a Cys-rich domain and 2 fibronectin type III repeats. The ephrin receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2015].
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.