SIAH1(SIAH1) (AK094663) Human Untagged Clone

CAT#: SC105440

(untagged)-Human cDNA FLJ37344 fis, clone BRAMY2021139, highly similar to Seven in absentia

USD 618.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name SIAH1(SIAH1) (AK094663) Human Untagged Clone
Symbol SIAH1
Vector pCMV6-XL4
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC105440 sequence for AK094663 edited (data generated by NextGen Sequencing)
ATGGTTATAATTATTTTTCTCCTGCCTCCTTATGTATTTATTTCAGAAATGAGCCGTCAG
ACTGCTACAGCATTACCTACCGGTACCTCGAAGTGTCCACCATCCCAGAGGGTGCCTGCC
CTGACTGGCACAACTGCATCCAACAATGACTTGGCGAGTCTTTTTGAGTGTCCAGTCTGC
TTTGACTATGTGTTACCGCCCATTCTTCAATGTCAGAGTGGCCATCTTGTTTGTAGCAAC
TGTCGCCCAAAGCTCACATGTTGTCCAACTTGCCGGGGCCCTTTGGGATCCATTCGCAAC
TTGGCTATGGAGAAAGTGGCTAATTCAGTACTTTTCCCCTGTAAATATGCGTCTTCTGGA
TGTGAAATAACTCTGCCACACACAGAAAAAGCAGACCATGAAGAGCTCTGTGAGTTTAGG
CCTTATTCCTGTCCGTGCCCTGGTGCTTCCTGTAAATGGCAAGGCTCTCTGGATGCTGTA
ATGCCCCATCTGATGCATCAGCATAAGTCCATTACAACCCTACAGGGAGAGGATATAGTT
TTTCTTGCTACAGACATTAATCTTCCTGGTGCTGTTGACTGGGTGATGATGCAGTCCTGT
TTTGGCTTTCACTTCATGTTAGTCTTAGAGAAACAGGAAAAATACGATGGTCACCAGCAG
TTCTTCGCAATCGTACAGCTGATAGGAACACGCAAGCAAGCTGAAAATTTTGCTTACCGA
CTTGAGCTAAATGGTCATAGGCGACGATTGACTTGGGAAGCGACTCCTCGATCTATTCAT
GAAGGAATTGCAACAGCCATTATGAATAGCGACTGTCTAGTCTTTGNCACCAGCATTGCA
CAGCTTTTTGCAGAAAATGGCAATTTAGGCATCAATGTAACTATTTCCATGTGTTGA

Clone variation with respect to AK094663.1
827 c=>n
5' Read Nucleotide Sequence
>OriGene 5' read for AK094663 unedited
GTATACGACTCCTATAGGGCGGCCGCGATTCGGCACGAGGATTCTCTTGTATAATTTAAG
TGATCTCTGGATTACTTAATACAATGTAAACAATATGTAAATAGTTGTTATAGACTGTAT
TTTAAAAATTTTGTATTCTTTATAAATTTTTCTGAATATTTTCAATCCATGGCTGGTGAA
GTCCTCGGATGCAGACCGTGTGGATACAGAGTGCCGATTTTATACAGGAGTTCACCTGTA
ACTCCCTGTACCTATCAACAGCTGACTCCAAATTAGAAAGAAATAGAGTAAGGGAGCCTC
AGGGAGAGTCCTAGCAAAACGGATTCGATTAAACTTCAGTTCCTTGTATAGTTTCTTTAG
TTGTTTATGGTCCATTTTCTATTTTAGCATTTATTATTCTATGTAGTCTATCCAAAGACG
ATTAAGGGAGTTCCACATGTTTTCCGGAACATTTTGAAAAGAGAGCTTATCCAGTGTACA
GATCCTAATAAAGTGCACATTCAGTGTAATTTTATTTTTTTAATATCTTTTTTAATCCTA
TTTTTCTTCCTCTTTTGCTCAGTAAATTTTGTATGAAACTTTAAAAGGACTTATGGCATG
TAAACATTATTTATAAAGTAAGTCATGGTTATAATTATTTTTCTCCTGCCTCCTTATGTA
TTTATTTCAGAAATGAGCCGTCAGACTGCTACAGCATTACCTACCGGTACCTCGAAGTGT
CCACCATTCCCAGAGGTGCCTGCCCTGACTGGCACAACTGCATCCAACANTGACTTGGCG
AGTCTTTTTGAGTGTCCAGTCTGCTTTGACTATGTNGTACCGNCCATTCTTCATGTCAGA
GTGCCATCTTGTTTGTAGCAACTGTCGCCCAAGCTCACATGTNGTCCAACTGCCNGGGCC
NNTTTGGATCCANCGCACTTTGCTTNGAGAAAGTGCTN
3' Read Nucleotide Sequence
>OriGene 3' read for AK094663 unedited
CTATGTACTCGGCCGCAATCGAGAGTCGAGTTTTTTCTTTTTTTTTTTTTAATTTGCATT
TTTTTTTTTTAATGTATAATTATGAAAGACCAAAAACATTTTTTGCAAACTGCCTTTTTA
AACAAATGATTTGCTTTTAATTACAAATACTGTGCATGACGATGCCTTCTTCTGCAAAAC
CAATAAATACAAGAACAAATTTTAAAATATGTGATTTGTCCAAGATATCTGAAAAATGAA
ACAAAAGCCTGATTTGCAGTATTTATAAAAATCAATTTATTCTCTAACCTTTCAAAGATT
AAGCTCAAAGGTGTGACTCATCTGTAGAAGACAGAAAAGAGAGCACCTTATAGATGCTTT
AAATAGCTTTTGATTATTTTTCCGATGTCACCTTTACTTTCTGGAACTCATGGCTTCACA
AAATAGCTGATTTTAAAATATTTCTAATGAACTGATTAATGGGGGAAAAGAAAATATTGA
ACACGTTATAAATTTTTTACCATAAACAAATATGCATATCAAAAGATACTAACTTTAAAA
TGGTACAAAAAAAGGAAAAACCTGAATTACAGAAAAGTCGAATTTATTTAATGAAAAACT
AAAATTAATAAAAATTAGCCNATTCTCACAAAAGAAGCACACAGCAGCACTATGTATTGA
CTCACAAAGGGAAAAGCAGTGGCCCATGACCACTTCAGATGGCTTGTCNGTTTAAGGAGA
AAAACCCTAACACGCACACTCCCTCGCAGGCTCACACTCCCACGCAAAAACAAACTTTTC
AAAATACATCAATCTCCACAAAACAAACTCAGATTATTTACAAGCTTCTTTCTAAACAAA
GAGCCATCTGGGTGAAAACAATATTTTCAGGGTTACTGGGCTTATTTAAATATAAGTACT
CTGCACGTTCCGGTTAAACCTTTTTTA
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN AK094663
ORF Size 2829 bp
Insert Size 2500
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq Size 2829
Locus ID 6477
Cytogenetics 16q12.1
Domains Sina
Protein Families Druggable Genome
Protein Pathways p53 signaling pathway, Ubiquitin mediated proteolysis, Wnt signaling pathway
Gene Summary This gene encodes a protein that is a member of the seven in absentia homolog (SIAH) family. The protein is an E3 ligase and is involved in ubiquitination and proteasome-mediated degradation of specific proteins. The activity of this ubiquitin ligase has been implicated in the development of certain forms of Parkinson's disease, the regulation of the cellular response to hypoxia and induction of apoptosis. Alternative splicing results in several additional transcript variants, some encoding different isoforms and others that have not been fully characterized. [provided by RefSeq, Jul 2008].
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.