CDC14B (XM_211142) Human Untagged Clone

CAT#: SC105245

(untagged)-Human LOC283655 (LOC283655)

USD 618


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name CDC14B (XM_211142) Human Untagged Clone
Symbol CDC14B
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC105245 sequence for XM_211142 edited (data generated by NextGen Sequencing)
ATGGTATCAAAAGAACTTGTCACTGTACATATCGGAAATGGTAAAAATATGTTTTGCCGT
TTTCACGAATTCATTCATTTTTCATGTTTCATGAATTCATTCTTTTTAAAAAAAAAAAAT
CCTGCTAATTCTCTGTTTCTCTTGCTTTTCTCCTTTATGACTAAGTTTTCCTCATTATGG
GTTACCCCACATTACTGCTTACGAAGACATCTCTTTAGTCAGAAAACAGTAGCTTGGTTC
AGTTCTAGCTTCATTGTTAAGCTCATAGGTAAATCTGGCAAATGGCTAGAAACAGTCACA
TGTTTGCTTGTCCTTAATGCTCTCACCTTTTCCCAGCTATTTGGATGTATATACTTTTGC
TTACTTTGTAGTGTACCAACTTAA

Clone variation with respect to XM_211142.2
5' Read Nucleotide Sequence
>OriGene 5' read for XM_211142 unedited
TAATACGACTCACTATAGGGCGGCCGCGAATTCGGCACGAGGAGGAGGCTGAGGCAGGAG
AATTGCTTGAACCCGGGAGGCGGAGTTTGCAGTGAGCCAAGATAGTGCCATCGCACTCCA
GCCTGGACAACAGAGCGAGACTCCATCTAAAAAAAAAAAAAAAAAAAAAAAAAACTCAGT
TTTTGGTTTTGAAAATGTCATGATACCTGTTGAGATAACTGCTGAATAGATGGGTAATAC
ACAGTCTAGGGCATGGTATCAAAAGAACTTGTCACTGTACATATCGGAAATGGTAAAAAT
ATGTTTTGCCGTTTTCACGAATTCATTCATTTTTCATGTTTCATGAATTCATTCTTTTTA
AAAAAAAAAAAATCCTGCTAATTCTCTGTTTCTCTTGCTTTTCTCCTTTATGACTAAGTT
TTCCTCATTATGGGTTACCCCACATTACTGCTTACGAAGACATCTCTTTAGTCAAAAAAC
AGTAGCTTGGTTCAGTTCTAGCTTCATTGTTAAGCTCATAGGTAAATCTGGCAAATGGCT
AGAAACAGTCACATGTTTGCTTGTCCTTAATGCTCTCACCTTTTCCCAGCTATTTGGATG
TATATACTTTTGCTTACTTTGNAGTGTACCAACTTAATACATGTTATAGACTAAATGTTT
ATGTCCTCCCAAACTTCATATTTTGGAAGCCAGACATGGTAACTCACACCTGTAGACCTA
ACACTTNTGGAGGCCTAAGTGGGAGGATTGCTTGAGTCCGGGAAGTCAACACCAGCCTGA
ACACATAGTGAGACCCCGTCTCTACAAAAAAAAAAAAAAAACTCGACTCTAGATGGCGGC
CGCGGTCATAGCTGTTTCCTGAACAGATCCCNGGTGGCATCCTTGTGACCCTTCCCCATG
CCTTCTCTGGNCCTGGAAAGTGCCACTCCATGCGCACCAA
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN XM_211142
ORF Size 2922 bp
Insert Size 800
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq Size 2922
RefSeq ORF 2922
Locus ID 8555
Cytogenetics 9q22.32-q22.33
Protein Families Phosphatase, Druggable Genome
Protein Pathways Cell cycle
Gene Summary The protein encoded by this gene is a member of the dual specificity protein tyrosine phosphatase family. This protein is highly similar to Saccharomyces cerevisiae Cdc14, a protein tyrosine phosphatase involved in the exit of cell mitosis and initiation of DNA replication, which suggests the role in cell cycle control. This protein has been shown to interact with and dephosphorylates tumor suppressor protein p53, and is thought to regulate the function of p53. Alternative splice of this gene results in 3 transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2008]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.