S6K1(RPS6KB1) (XM_027798) Human Untagged Clone

CAT#: SC104690

(untagged)-Human ribosomal protein S6 kinase, 70kD, polypeptide 1 (RPS6KB1)

USD 618.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name S6K1(RPS6KB1) (XM_027798) Human Untagged Clone
Symbol RPS6KB1
Vector pCMV6-XL4
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for XM_027798, the custom clone sequence may differ by one or more nucleotides


ATGATAGTAAGAAATGCTAAAGATACAGCTCATACAAAAGCAGAATGGAATATTCTGGAGGAAGTAAGGC
ATCCCTTCATTGTGGATTTAACTTATGCCTTTCAGACTGGTGGAAAACTCTACCTCATCCTTGAGTATCT
CAGTGGAGGAGAACTATTTATGCAGTTAGAAAGAGAGGGAATATTTATGGAAGACACTGCCTGCTTTTAC
TTGGCAGAAATCTCCATGGCTTTGGGACATTTACATCAAAAGGGGATCATATACAGAGACCTGAAGCCGG
AGAATATCATTCTTAATCACCAAGGTCATATGAAACTAACAGACTTTGGACTACGCAAAGAATCTATTCA
TGATGGAACAGTCACACACACATTTTGTGGAACAATAGAATACATGGCCCCTGAAATCTTGATGAGAAGT
GGCCACAATCGTGCTGTGGATTGA


5' Read Nucleotide Sequence
>OriGene 5' read for XM_027798 unedited
TTTGGCCAGTTCAGAATTTGTATACGACTCATATAGGGCGGCCGCGAATTCGCACGAGGC
CGGTGATGGCGGCAGCGGCTGTGGTGGCTGCGGCGGGTCCGGGCCCATGAGGCGACGAAG
GAGGCGGGACGGCTTTTACCCAGCCCCGGACTTCCGAGACAGGGAAGCTGAGGACATGGC
AGGAGTGTTTGACATAGACCTGGACCAGCCAGAGGACGCGGGCTCTGAGGATGAGCTGGA
GGAGGGGGGTCAGTTAAATGAAAGCATGGACCATGGGGGAGTTGGACCATATGAACTTGG
CATGGAACATTGTGAGAAATTTGAAATCTCAGAAACTAGTGTGAACAGAGGGCCAGAAAA
AATCAGACCAGAATGTTTTGAGCTACTTCGGGTACTTGGTAAAGGGGGCTATGGAAAGGT
TTTTCAAGTACGAAAAGTAACAGGAGCAAATACTGGGAAAATATTTGCCATGAAGGTGCT
TAAAAAGGCAATGATAGTAAGAAATGCTAAAGATACAGCTCATACAAAAGCAGAACGGAA
TATTCTGGAGGAAGTAAAGCATCCCTTCATCGTGGATTTAATTTATGCCTTTCAGACTGG
TGGAAAACTCTACCTCATCCTTGAGTATCTCAGTGGAGGAGAACTATTTATGCAGTTAGA
AAGAGAGGGAATATTTATGGAAGACACTGCCTGCTTTTACTTGGCAGAAATCTCCATGGC
TTTGGGGCATTTACATCAAAAGGGGATCATCTACAGAGACCTGAAGCCGGAGAATATCAT
GCTTAATCACCAAGGTCATGTGAAACTAACAGACTTTGGACTATGCAAAGAATCTATTCA
TGATGGAACAGTCACACACACATTTTGTGGAACAATAGAATACATGGGCCCTGGAATCT
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN XM_027798
ORF Size 846 bp
Insert Size 2350
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq Size 846
Locus ID 6198
Cytogenetics 17q23.1
Domains pkinase, TyrKc, S_TKc
Protein Families Protein Kinase, Druggable Genome
Protein Pathways ErbB signaling pathway, mTOR signaling pathway, TGF-beta signaling pathway, Fc gamma R-mediated phagocytosis, Insulin signaling pathway, Acute myeloid leukemia
Gene Summary This gene encodes a member of the ribosomal S6 kinase family of serine/threonine kinases. The encoded protein responds to mTOR (mammalian target of rapamycin) signaling to promote protein synthesis, cell growth, and cell proliferation. Activity of this gene has been associated with human cancer. Alternatively spliced transcript variants have been observed. The use of alternative translation start sites results in isoforms with longer or shorter N-termini which may differ in their subcellular localizations. There are two pseudogenes for this gene on chromosome 17. [provided by RefSeq, Jan 2013].
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.