ATP5H (BC032245) Human Untagged Clone

CAT#: SC104218

ATP5H (untagged)-Homo sapiens, ATP synthase, H+ transporting, mitochondrial F0 complex, subunit d, clone MGC:39974 IMAGE:5167128, complete cds

USD 1,113


Availability*
2 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name ATP5H (BC032245) Human Untagged Clone
Symbol ATP5H
Synonyms ATPQ;ATP5JD; ATP synthase D chain, mitochondrial; ATP synthase, H+ transporting, mitochondrial F1F0, subunit d; My032 protein; ATP synthase, H+ transporting, mitochondrial F0 complex, subunit d
Vector pCMV6-XL4
Sequence Data
Fully Sequenced ORF
>OriGene ORF sequence for BC032245 edited
ATGGCTGGGCGAAAACTTGCTCTAAAAACCATTGACTGGGTAGCTTTTGCAGAGATCATA
CCCCAGAACCAAAAGGCCATTGCTAGTTCCCTGAAATCCTGGAATGAGACCCTCACCTCC
AGGTTGGCTGCTTTACCTGAGAATCCACCAGCTATCGACTGGGCTTACTACAAGGCCAAT
GTGGCCAAGGCTGGCTTGGTGGATGACTTTGAGAAGAAGTTTAATGCGCTGAAGGTTCCC
GTGCCAGAGGATAAATATACTGCCCAGGTGGATGCCGAAGAAAAAGAAGATGTGAAATCT
TGTGCTGAGTGGGTGTCTCTCTCAAAGGCCAGGATTGTAGAATATGAAAAAGAGATGGAG
AAGATGAAGAACTTAATTCCATTTGATCAGATGACCATTGAGGACTTGAATGAAGCTTTC
CCAGAAACCAAATTAGACAAGAAAAAGTATCCCTATTGGCCTCACCAACCAATTGAGAAT
TTATAA
5' Read Nucleotide Sequence
>OriGene 5' read for BC032245 unedited
GGGTTCAAAATTTGTAATACGACTCACTCATAGGGCGGCCGCGAATTCGCACCGCCGGGT
CGGTGAAGGATCCCAAAATGGCTGGGCGAAAACTTGCTCTAAAAACCATTGACTGGGTAG
CTTTTGCAGAGATCATACCCCAGAACCAAAAGGCCATTGCTAGTTCCCTGAAATCCTGGA
ATGAGACCCTCACCTCCAGGTTGGCTGCTTTACCTGAGAATCCACCAGCTATCGACTGGG
CTTACTACAAGGCCAATGTGGCCAAGGCTGGCTTGGTGGATGACTTTGAGAAGAAGTTTA
ATGCGCTGAAGGTTCCCGTGCCAGAGGATAAATATACTGCCCAGGTGGATGCCGAAGAAA
AAGAAGATGTGAAATCTTGTGCTGAGTGGGTGTCTCTCTCAAAGGCCAGGATTGTAGAAT
ATGAAAAAGAGATGGAGAAGATGAAGAACTTAATTCCATTTGATCAGATGACCATTGAGG
ACTTGAATGAAGCTTTCCCAGAAACCAAATTAGACAAGAAAAAGTATCCCTATTGGCCTC
ACCAACCAATTGAGAATTTATAAAATTGAGTCCAGGAGGAAGCTCTGGCCCTTGTATTAC
ACATTCTGGACATTAAAAATAATAATTATACAGTTCAAAAAAAAAAAAAAAAAAACTCGA
CTCTAGATTGCGGCCGCGGTCATAGCTGTTTCCTGAACAGATCCCCGGTTGCATTCCCTG
TGACCCCTCCCCAGTGCCTCTCCTGGCCCTGGAAGTTCCACTTCAGTGCCCACCAGCCTT
GTCCTATAAAAATAAGTNGCATCATTTTGTCTGACTAAGTGTCCCTCTATATACTATCGG
GTGAAGGGCGTGGATTGGACCAGGGGCAATTTGGAAAAACAACTTTTGGCCCGCGGGGTC
ATTGGGAACCACC
3' Read Nucleotide Sequence
>OriGene 3' read for BC032245 unedited
GGTACTACTATGNNACCGCGGCCGCAATCTANGATCGAGTTTTTTTTTTTTTTTTTTTGA
ACTGTATAATTATTATTTTTAATGTCCAGAATGTGTAATACAAGGGCCAGAGCTTCCTCC
TGGACTCAATTTTATAAATTCTCAATTGGTTGGTGAGGCCAATAGGGATACTTTTTCTTG
TCTAATTTGGTTTCTGGGAAAGCTTCATTCAAGTCCTCAATGGTCATCTGATCAAATGGA
ATTAAGTTCTTCATCTTCTCCATCTCTTTTTCATATTCTACAATCCTGGCCTTTGAGAGA
GACACCCACTCAGCACAAGATTTCACATCTTCTTTTTCTTCGGCATCCACCTGGGCAGTA
TATTTATCCTCTGGCACGGGAACCTTCAGCGCATTAAACTTCTTCTCAAAGTCATCCACC
AAGCCAGCCTTGGCCACATTGGCCTTGTAGTAAGCCCAGTCGATAGCTGGTGGATTCTCA
GGTAAAGCAGCCAACCTGGAGGTGAGGGTCTCATTCCAGGATTTCAGGGAACTAGCAATG
GCCCTTTGGTTCTGGGGTATGATCTCTGCAAAAGCTCCCCCATCAATGGTTTTTAGAGCA
AAGTTTTCCCCACCCCTTTGGGATCCTTCCCCGACCCTGGCTGTGGCCAAATTCTCGGGC
CGCCCTTAGTGAGTCCTATTAAAAAAATTCTGACCGTTCATTAAACAAGCTTTGGTTATT
TAAACCTCCACCGGTCCCCCCCTCCCGCCCTTTTTGGTTACCGGGGGGGGTTTTTCCAAA
TTTTGGAAAGTCCCGTTGATTTTGGGGCCCAAAAAACCCCCTTTGACGTCAAGGGGGGGG
AAACTGGAAATCCCCCTGGGTAAAACCCCTTTCCCCCCCCTTGTGGGTCTGCCAAAA
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN BC032245
ORF Size 414 bp
Insert Size 420
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq BC032245.1, AAH32245
RefSeq Size 592
RefSeq ORF 414
Locus ID 10476
Cytogenetics 17q25.1
Protein Pathways Oxidative phosphorylation, Metabolic pathways, Alzheimer's disease, Parkinson's disease, Huntington's disease
Gene Summary Mitochondrial ATP synthase catalyzes ATP synthesis, utilizing an electrochemical gradient of protons across the inner membrane during oxidative phosphorylation. It is composed of two linked multi-subunit complexes: the soluble catalytic core, F1, and the membrane-spanning component, Fo, which comprises the proton channel. The F1 complex consists of 5 different subunits (alpha, beta, gamma, delta, and epsilon) assembled in a ratio of 3 alpha, 3 beta, and a single representative of the other 3. The Fo seems to have nine subunits (a, b, c, d, e, f, g, F6 and 8). This gene encodes the d subunit of the Fo complex. Alternatively spliced transcript variants encoding different isoforms have been identified for this gene. In addition, three pseudogenes are located on chromosomes 9, 12 and 15. [provided by RefSeq, Jun 2010].
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.