MCM2 (XM_042618) Human Untagged Clone

CAT#: SC103755

(untagged)-Human MCM2 minichromosome maintenance deficient 2, mitotin (S. cerevisiae) (MCM2)

USD 196


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name MCM2 (XM_042618) Human Untagged Clone
Symbol MCM2
Vector pCMV6-XL4
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC103755 sequence for XM_042618 edited (data generated by NextGen Sequencing)
ATGGCGGAATCATCGGAATCCTTCACCATGGCATCCAGCCCGGCCCAGCGTCGGCGAGGC
AATGATCCTCTCACCTCCAGCCCTGGCCGAAGCTCCCGGCGTACTGATGCCCTCACCTCC
AGCCCTGGCCGTGACCTTCCACCATTTGAGGATGAGTCCGAGGGGCTCCTAGGCACAGAG
GGGCCCCTGGAGGAAGAAGAGGATGGAGAGGAGCTCATTGGAGATGGCATGGAAAGGGAC
TACCGCGCCATCCCAGAGCTGGACGCCTATGAGGCCGAGGGACTGGCTCTGGATGATGAG
GACGTAGAGGAGCTGACGGCCAGTCAGAGGGAGGCAGCAGAGCGGGCCATGCGGCAGCGT
GACCGGGAGGCTGGCCGGGGCCTGGGCCGCATGCGCCGTGGGCTCCTGTATGACAGCGAT
GAGGAGGACGAGGAGCGCCCTGCCCGCAAGCGCCGCCAGGTGGAGCGGGCCACGGAGGAC
GGCGAGGAGGACGAGGAGATGATCGAGAGCATCGAGAACCTGGAGGATCTCAAAGGCCAC
TCTGTGCGCGAGTGGGTGAGCATGGCGGGCCCCCGGCTGGAGATCCACCACCGCTTCAAG
AACTTCCTGCGCACTCACGTCGACAGCCACGGCCACAACGTCTTCAAGGAGCGCATCAGC
GACATGTGCAAAGAGAACCGTGAGAGCCTGGTGGTGAACTATGAGGACTTGGCAGCCAGG
GAGCACGTGCTGGCCTACTTCCTGCCTGAGGCACCGGCGGAGCTGCTGCAGATCTTTGAT
GAGGCTGCCCTGGAGGTGGTACTGGCCATGTACCCCAAGTACGACCGCATCACCAACCAC
ATCCATGTCCGCATCTCCCACCTGCCTCTGGTGGAGGAGCTGCGCTCGCTGAGGCAGCTG
CATCTGAACCAGCTGATCCGCACCAGTGGGGTGGTGACCAGCTGCACTGGCGTCCTGCCC
CAGCTCAGCATGGTCAAGTACAACTGCAACAAGTGCAATTTCGTCCTGGGTCCTTTCTGC
CAGTCCCAGAACCAGGAGGTGAAACCAGGCTCCTGTCCTGAGTGCCAGTCGGCCGGCCCC
TTTGAGGTCAACATGGAGGAGACCATCTATCAGAACTACCAGCGTATCCGAATCCAGGAG
AGTCCAGGCAAAGTGGCGGCTGGCCGGCTGCCCCGCTCCAAGGACGCCATTCTCCTCGCA
GATCTGGTGGACAGCTGCAAGCCAGGAGACGAGATAGAGCTGACTGGCATCTATCACAAC
AACTATGATGGCTCCCTCAACACTGCCAATGGCTTCCCTGTCTTTGCCACTGTCATCCTA
GCCAACCACGTGGCCAAGAAGGACAACAAGGTTGCTGTAGGGGAACTGACCGATGAAGAT
GTGAAGATGATCACTAGCCTCTCCAAGGATCAGCAGATCGGAGAGAAGATCTTTGCCAGC
ATTGCTCCTTCCATCTATGGTCATGAAGACATCAAGAGAGGCCTGGCTCTGGCCCTGTTC
GGAGGGGAGCCCAAAAACCCAGGTGGCAAGCACAAGGTACGTGGTGATATCAACGTGCTC
TTGTGCGGAGACCCTGGCACAGCGAAGTCGCAGTTTCTCAAGTATATTGAGAAAGTGTCC
AGCCGAGCCATCTTCACCACTGGCCAGGGGGCGTCGGCTGTGGGCCTCACGGCGTATGTC
CAGCGGCACCCTGTCAGCAGGGAGTGGACCTTGGAGGCTGGGGCCCTGGTTCTGGCTGAC
CGAGGAGTGTGTCTCATTGATGAATTTGACAAGATGAATGACCAGGACAGAACCAGCATC
CATGAGGCCATGGAGCAACAGAGCATCTCCATCTCGAAGGCTGGCATCGTCACCTCCCTG
CAGGCTCGCTGCACGGTCATTGCTGCCGCCAACCCCATAGGAGGGCGCTACGACCCCTCG
CTGACTTTCTCTGAGAACGTGGACCTCACAGAGCCCATCATCTCACGCTTTGACATCCTG
TGTGTGGTGAGGGACACCGTGGACCCAGTCCAGGACGAGATGCTGGCCCGCTTCGTGGTG
GGCAGCCACGTCAGACACCACCCCAGCAACAAGGAGGAGGAGGGGCTGGCCAATGGCAGC
GCTGCTGAGCCCGCCATGCCCAACACGTATGGCGTGGAGCCCCTGCCCCAGGAGGTCCTG
AAGAAGTACATCATCTACGCCAAGGAGAGGGTCCACCCGAAGCTCAACCAGATGGACCAG
GACAAGGTGGCCAAGATGTACAGTGACCTGAGGAAAGAATCTATGGCGACAGGCAGCATC
CCCATTACGGTGCGGCACATCGAGTCCATGATCCGCATGGCGGAGGCCCACGCGCGCATC
CATCTGCGGGACTATGTGATCGAAGACGACGTCAACATGGCCATCCGCGTGATGCTGGAG
AGCTTCATAGACACACAGAAGTTCAGCGTCATGCGCAGCATGCGCAAGACTTTTGCCCGC
TACCTTTCATTCCGGCGTGACAACAATGAGCTGTTGCTCTTCATACTGAAGCAGTTAGTG
GCAGAGCAGGTGACATATCAGCGCAACCGCTTTGGGGCCCAGCAGGACACTATTGAGGTC
CCTGAGAAGGACTTGGTGGATAAGGCTCGTCAGATCAACATCCACAACCTCTCTGCATTT
TATGACAGTGAGCTCTTCAGGATGAACAAGTTCAGCCACGACCTGAAAAGGAAAATGATC
CTGCAGCAGTTCTGA

Clone variation with respect to XM_042618.7
504 t=>c
5' Read Nucleotide Sequence
>OriGene 5' read for XM_042618 unedited
TATACGACTCACTATAGGGCGGCCCGCGAATTCGCACGAGGGTTGCTGTAGTGGCGGAGA
GGATCGTGGTACTGCTATGGCGGAATCATCGGAATCCTTCACCATGGCATCCAGCCCGGC
CCAGCGTCGGCGAGGCAATGATCCTCTCACCTCCAGCCCTGGCCGAAGCTCCCGGCGTAC
TGATGCCCTCACCTCCAGCCCTGGCCGTGACCTTCCACCATTTGAGGATGAGTCCGAGGG
GCTCCTAGGCACAGAGGGGCCCCTGGAGGAAGAAGAGGATGGAGAGGAGCTCATTGGAGA
TGGCATGGAAAGGGACTACCGCGCCATCCCAGAGCTGGACGCCTATGAGGCCGAGGGACT
GGCTCTGGATGATGAGGACGTAGAGGAGCTGACGGCCAGTCAGAGGGAGGCAGCAGAGCG
GGCCATGCGGCAGCGTGACCGGGAGGCTGGCCGGGGCCTGGGCCGCATGCGCCGTGGGCT
CCTGTATGACAGCGATGAGGAGGACGAGGAGCGCCCTGCCCGCAAGCGCCGCCAGGTGGA
GCGGGCCACGGAGGACGGCGAGGAGGACGAGGAGATGATCGAGAGCATCGAGAACCTGGA
GGATCTCATAGGCCACTCTGTGCGCGAGTGGGTGAGCATGGCGGGCCCCCGGCTGGAGAT
CCACCACCGCTTCAAGAACTTCCTGCGCACTCACGTCGACAGCCACGGCCACAACGTCTT
CAAGGAGCGCATCAGCGACATGTGCANAGAGAACCGTGAGAGCCTGGTGGTGAACTATNG
AGACTNGNCAGNCAGGNAGCACGTGCTGGCCTACTTTCTGCCTGNAGCACCCGGCGAGCT
GCTGCAAATCTTTGATGANGCTGCCCTGGGAGTGGTACTGGCCATGTACCCCCAGTACGA
CCGNTNACCCAACACATCCATGTCCGCATCT
3' Read Nucleotide Sequence
>OriGene 3' read for XM_042618 unedited
CGTTACAGCTATGNNACCGCGGCCGCATNCTANGATCGAGTTTTTTTTTTTTTTTTTTTA
TATTTTATTCAACTTTATTAAAAATTAAAACTACAGAAACCAAACCGAATGCACAAATAA
GAGAGTGGGGAAACAGACAGGGAGCAATGGCAGCTGATAACTGTGGCGAGTGGATAATCC
GCATGACTCACATCCCACCCCTGCGACTGAGGAGCCCAGAACGCTGCGCTGGCACTGTCG
TGCCCTCTTCCACCACAGGGGCACAGAAACCTGCAGGAGACTGAAAACGATTACAAACAT
CTTCAACCAGCTCTCTGGCCAAAGGCAGCAAAAGCAGCCTGAATACGCAACTCACGCCAA
GAGGGCAGCAGCTCTCCTGACATCCATGTAAGAAGGCTAACACCTAAACCACACGCAGGC
ATCCTGAACTCAGCAGCTCTGATCCAAGGTACTGAGTGGAGACAAAGCACTCGGAGGTGG
CAAGATGTTCAGCAACCAAGTAAGACACACTGGCAAGGCATCCCACCCAAAGGTGAGAAG
CACAAAGCAGGCTTGGAGAAACAAACAGTCATGCCAGGTGCAGCCAGACATCCTGCTATA
AGCCCTGACCCTAGTACCCCGAGTTCATCAAGTGCTCTGGTTTTGTGTCCATAAAGCACA
GAGGCACTGACCACCCCAAACCCAGATCCCCAAGAATCCTTATTGATGGCATAAGGGCCT
CAAAACTGCTGGCAGATCATTTTTCCTTTCAAGGCCTGGCCTGAACTTGTTCATCCCTGA
AAGCTCCCTGTCTTAAATGCCAAAAAGTTGTGGATTGTTAATCTGACAACCTATTCCCCA
GTTCCTTTTAGGACCCAAAAATGGTCTGTTGGGCCCCAAACGGTGGCCTTGATGTCAACT
GGT
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN XM_042618
ORF Size 3402 bp
Insert Size 3700
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq Size 3402
RefSeq ORF 3402
Locus ID 4171
Cytogenetics 3q21.3
Domains MCM
Protein Families Stem cell - Pluripotency, Transcription Factors, Druggable Genome
Protein Pathways DNA replication, Cell cycle
Gene Summary The protein encoded by this gene is one of the highly conserved mini-chromosome maintenance proteins (MCM) that are involved in the initiation of eukaryotic genome replication. The hexameric protein complex formed by MCM proteins is a key component of the pre-replication complex (pre_RC) and may be involved in the formation of replication forks and in the recruitment of other DNA replication related proteins. This protein forms a complex with MCM4, 6, and 7, and has been shown to regulate the helicase activity of the complex. This protein is phosphorylated, and thus regulated by, protein kinases CDC2 and CDC7. Multiple alternatively spliced transcript variants have been found, but the full-length nature of some variants has not been defined. [provided by RefSeq, Oct 2012]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.