ADO (NM_032804) Human Untagged Clone

CAT#: SC103692

Reviews ()
Write a review

ADO (untagged)-Human 2-aminoethanethiol (cysteamine) dioxygenase (ADO)



  "NM_032804" in other vectors (6)

USD 310.00


Availability*
In Stock

Size
    • 10 ug


Product images

Specifications

Product Data
Product Name ADO (NM_032804) Human Untagged Clone
Type Human Untagged Clone
Tag Tag Free
Symbol ADO
Synonyms C10orf22
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Cell Selection None
Sequence Data
>OriGene ORF within SC103692 sequence for NM_032804 edited (data generated by NextGen Sequencing)
ATGCCCCGAGACAACATGGCCTCCTTGATCCAACGGATCGCCCGCCAGGCTTGCCTCACC
TTCCGGGGCAGCGGGGGCGGCCGCGGCGCTTCCGATCGCGACGCGGCTTCTGGCCCGGAG
GCGCCGATGCAGCCGGGCTTCCCCGAGAACCTGAGCAAGCTGAAGAGCCTCCTGACCCAG
CTCCGCGCCGAGGACTTGAACATCGCCCCGCGCAAGGCCACACTGCAGCCGCTGCCGCCC
AACCTGCCGCCAGTCACCTACATGCACATCTACGAGACGGACGGCTTCAGCCTGGGCGTG
TTCCTGCTCAAGAGCGGCACGTCCATCCCGCTGCACGACCACCCGGGCATGCACGGCATG
CTCAAGGTGCTGTACGGCACCGTGCGCATCAGCTGCATGGACAAGCTAGACGCGGGCGGC
GGGCAACGGCCGCGGGCCTTGCCGCCCGAGCAGCAGTTCGAGCCGCCGCTGCAGCCCCGG
GAGCGAGAAGCCGTGCGGCCGGGCGTGCTGCGTTCGCGGGCCGAGTACACCGAGGCCAGC
GGCCCCTGCATCCTCACACCGCACCGGGACAACCTGCACCAGATCGACGCCGTGGAAGGG
CCTGCCGCCTTCCTGGACATCCTGGCCCCGCCCTACGACCCGGACGATGGCCGGGACTGC
CACTATTACCGGGTGCTGGAGCCGGTCAGGCCCAAGGAGGCCTCCAGCTCGGCCTGTGAC
CTGCCTCGAGAGGTGTGGCTCCTGGAGACCCCACAGGCCGATGACTTCTGGTGCGAGGGA
GAACCCTATCCAGGTCCCAAGGTCTTCCCTTGA

Clone variation with respect to NM_032804.5
>OriGene 5' read for NM_032804 unedited
CGCGTGCGCGCTCAGAGGGGGCTCAAGGCGAGCGCGCCGGGCAGTTGCGGGCGCGTGGCT
GCTGAGGTTGGCGGCGGTGCCGCGCGCCCGACGGGCCGGTGGTTGCGGGGCCTCCCGCCT
CGACCCGGGCTGGGGGCAGCCGTGGCGGCCGCCGGGGACCGCAAGGGGCGGAGGAAAGGA
GGGGGCCGGTCCCGGCACGCAGAGGAGCAGCCGACCATGCCCCGAGACAACATGGCCTCC
TTGATCCAACGGATCGCCCGCCAGGCTTGCCTCACCTTCCGGGGCAGCGGGGGCGGCCGC
GGCGCTTCCGATCGCGACGCGGCTTCTGGCCCGGAGGCGCCGATGCAGCCGGGCTTCCCC
GAGAACCTGAGCAAGCTGAAGAGCCTCCTGACCCAGCTCCGCGCCGAGGACTTGAACATC
GCCCCGCGCAAGGCCACACTGCAGCCGCTGCCGCCCAACCTGCCGCCAGTCACCTACATG
CACATCTACGAGACGGACGGCTTCAGCCTGGGCGTGTTCCTGCTCAAGAGCGGCACGTNC
ATCCCGCTGCACGACCACCCGGGCATGCACGGCATGCTCAAGGTGCTGTACGGCACCGTG
CGCATCAGCTGCATGGACAAGCTAGACGCGGGCGGCGGNCAACGGCCGCGGGCCTTGCCG
NCCGAGCAGCAGTTCGAGCCGCCGCTGCAGCCCCGGGAGCGAAAACGGTGGCGCCNGGCG
TGCTGCGTTCGCGGGCCGAGTACACCGAGGCCANNGGCCCCTGCTNCTCACACCGNACCG
GGACACCTGCACANATCACACCCNGGGGAAAGCCCTGCGGCTTCCTGGC
>OriGene 3' read for NM_032804 unedited
CTATGGAACCGCGGCCGCAATCTAGAGTCGAGTTTTTTTTTTTTTTTTTTTTGAGGCAAT
TATTGCATTTATTATTCACCATAAAAGTGATTAATATCATTGTGCTCATTAGTCTTTCCA
AGGGGAAGATAACTTTTATCCCACAGTTGTTATTAAAACATTATCTATATTGGACGGAGT
ATATAGAAACACAATAGCAACACACCAAGTCAGTCACGACTAACAGTTTATGCACACAGG
TGCAAGATAGTTTCTGCACCACATTTTGTCTTTGTAATAAGCATATTCTTTCCTCAGTGG
CTCACTAAAACAAGTTATATTTTGTCTTCACCACTAATTTACTCAGAATTTATTAGTGAA
CCAAAAGTTTCACTGTTCTTATTGAACTAAATCTGAGATATCATATTGCTGTTTTGGCCT
GCAACAATTTCAGTTACTCTTTTGAAAAGCACCTTAGGTTTTTTCTTCCAAATTGCTCGT
AATTGAAAACTTTAAAACTTCTTTTTTTCATAATGAAGTCATAATTCTTCCTTTATTACT
ATCCTACAGCCAGGATGAGTTTTCGTAGCTTTAATGTACTAAGTTGTATTATAACACATA
CATTGCTATTAATAATCTTGGTAAGCTAATCAACTTTTTGCTACAATATAATCCAAAAAA
GTATGTGATTGATAACCACATTCATTACTGTGCTATGGAAAAAAAAACAAGATCTTTTAT
TTTGTGAAGTTTTCTAAGAAAATCATTTGCATATCTAAGAATTTATTTTCAAACTAAGTG
GCATGAAGAACTGCCTCAAACTGCCCCCAAAGGGCATTTTAAACTACCCCAAAATGTGGA
AGCTACCATAAAACACATTTAGCCACAATGGCGGGAAAAACTTGGTACATGGCCCGTGGT
CGGGTTTATAAAAAAGTGGCTGGCCCGGGGGAAAACCTTTTGGGTTTGGTTTGGGGTAAA
TTAAAAACACTCACAGTGTTTGCGTGTTT
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_032804
Insert Size 4000 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_032804.5, NP_116193.2
RefSeq Size 3739 bp
RefSeq ORF 813 bp
Locus ID 84890
Cytogenetics 10q21.3
Protein Pathways Metabolic pathways, Taurine and hypotaurine metabolism
Gene Summary Human thiol dioxygenases include cysteine dioxygenase (CDO; MIM 603943) and cysteamine (2-aminoethanethiol) dioxygenase (ADO; EC 1.13.11.19). CDO adds 2 oxygen atoms to free cysteine, whereas ADO adds 2 oxygen atoms to free cysteamine to form hypotaurine (Dominy et al., 2007 [PubMed 17581819]). [supplied by OMIM, Mar 2008]

Other Versions

Frequently bought together (2)
Anti-ADO Rabbit Polyclonal Antibody
    • 100 ul

USD 345.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 430.00

Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
68 Mouse Clones
Molbio tools