p35(CDK5R1) (BC035448) Human Untagged Clone

CAT#: SC103532

(untagged)-Homo sapiens, clone IMAGE:4939043

USD 618


Availability*
2 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name p35(CDK5R1) (BC035448) Human Untagged Clone
Symbol CDK5R1
Vector pCMV6-XL4
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for BC035448, the custom clone sequence may differ by one or more nucleotides


GCACCTGTCCCCCACGGACCCCGTGCTCTGGCTGCGCAGCGTGGACCGCTCGCTGCTTCTGCAGGGCTGG
CAGGACCAGGGCTTCATCACGCCGGCCAACGTGGTCTTCCTCTACATGCTCTGCAGGGATGTTATCTCCT
CCGAGGTGGGCTCGGATCACGAGCTCCAGGCCGTCCTGCTGACATGCCTGTACCTCTCCTACTCCTACAT
GGGCAACGAGATCTCCTACCCGCTCAAGCCCTTCCTGGTGGAGAGCTGCAAGGAGGCCTTTTGGGACCGT
TGCCTCTCTGTCATCAACCTCATGAGCTCAAAGATGCTGCAGATAAATGCCGACCCACACTACTTCACAC
AGGTCTTCTCCGACCTGAAGAACGAGAGCGGCCAGGAGGACAAGAAGCGGCTCCTCCTAGGCCTGGATCG
GTGAGCACTGTAGCCTGCGTCATGGCTCAAGGATTCAATGCATTTTTAAGAATTTATTATTAAATCAGTT
TTGTGTACAGTATGTGTCTAGCAAAGCCACCAAGGGCCTCACCTTTCCCACAGTCTCTCCCTGGGGTTTT
TTTCATCCCTGCCAAGAACTCTGGGCACTTTTGAACTCACGAGCCTTGCGCAAAACCCAGAAGATGTATT
CAGAGCCACCCAGGCCACTGACCTCCCACTTTGGGGAACTCAAAGGACTGACCTGCCCCTGCCGCCTGTG
CCCTTGCTGGGTCCAGGGTAGGCAAGGCTGCCGGCTGCACCCTGTATGGAGCTAGAGAGGGGCCTCTGGC
TGCCTGGCCCAGGGAGGAATTGGGGTTTCTGGTTGGAGGCCCTTTTCTGGCTCCTGTGTGGAGTTATTCA
CTCTCCCAGAGGCTCCTGGAGCCAGCCACCCTAACTGAGCTGCCAGTGGGGTCGTGAGGCAAGATCCCCG
CCACCCGGGGACATCTTCAATCTAGGCGAGGCGAAGCTGAGCGGGTCTAGTGGAAAGATTGTGTCTGGTC
GTTTGACCACACACCGCCCTGATTTGCTGTTTTCTTTTTTTAGGGAGAAGGGCTTTTCTTTAGTGGAGAA
ATGGAACTCGCCCCCCTACCCCCTTGTCTGCTGCTCCCAGCCACGTTGGTGGTATTGGCCGATGAGCTGG
TTTGACTCATTAATTTCTCTCAATTTGGGTCCCAGCTAAAGAGGTGGGGTGAAGCTGGGGACAGCTTTCC
TGGGTGAGTTTTTCTTTTGAATAATGTAGTGCAGTCACCCTGTGGCAAATGCCAGGACAGCTGCAGGTGC
CCATTAGCAACGCCTGCCTTCTGGGCAAGGTGAGGGATGCCATACCTTGAGACCAAGCCGGTGCCCACCT
AAGGGCTAAGGCCTCTTGCTGGTGCACATGACATTTGTCCTGCAGAGCTGGGGGGAAGGCGATGTGGTGA
CCCCACCCCCACCCGTTAATTTAAAGCTGTTTCTAAACAGTTGAGTTTCTTCTAAAGAGGAAGCCTTGCC
CAGCAAGGACCAGTGAGACAGCCGGATCTTGGAGACAATTACAAGACGGGGAGTGAGACTCCTGATTGCT
CTGGAAGCCTGCTGATTTCTACAACTGATCATTTGCAGCTGCTGGTTTTGGTTTCCACCTTACCCTACTG
GCTGTAAAAACACAAATGTGTACTTTATTGATTTTCTTTCTAATTCTCCCGCATTGGTGGCTTGGGACTT
GGGAGAGGGAGCAAGCCTTCCTCCATGGCCCATCACTCGGCTGTGGAGAACAAAGACCAATGTGAAGACA
CTACAGAGGATTCTGTCTTCCAGGCCCAGTCCACTGGGGAGTGCTGGAATGGGGACCTGGGGTGGGGAGG
CAGAGGGTCACTTTACATAGGATTAAGTTCGAGGTGGCTACCGATTTCAGCACATGCACTACTGAAATTT
ACACAAAAAGAAAGCTGTGAAATTGAAGTCCCAATTTAAGAGTCCTGAGGCAGAACCTGGTGGCTGGAGG
CATTCCCAGAGGTGGGGAAGAGAGCCTGCCCGGCCGGAGAACATCTGCCTTGCTGCACCTGAGGCCCAGC
AGAGCCGTTCCTGGGACTGTCAGATAATCGGTGCAGCGGTGGAAGGAGCCTGCGGCTGCTGGCACAGACT
TCACACAGCACCTCCTCTCTGCTGGGTTTCCACACAGCCTGTCTTCAGATCCTGCTGCCGCGTGCGACCA
GAGGTGGGAGGCCCCTGGTGGCATGGAAGAGGGAGGGTCAGTGCCAAGTCTCAGGAGGAGGGCGCATGTG
TGTATCACCCTCAGCTGGCGGAACCTGGCTGCGAACTGTGCAGTTACGTTGCATCCACAGGATTCCAGTT
GCGTGTCTGTTTCCTTCTCTTTCTCCGTATTTATTTTTTTATTCTTCGGAGGAGGTGGACATTTCGGAAG
TGGTGGGGACTAAGGGAAGAACTCTCTAGTTCCCTCAGTGTGAAGCCTGTCGTGTTCTCTCCCCTTGCAC
TGGTCATCAGTATTGTGTAAAGGAACAACTGATATACTTGAGTGTGCAAGCAAAGAACCCATTTGCCATG
CTGCTATGAAGACTACTTTTAGATCAACAATAAAAAAAAACCTACAAAAAAACCTTTATTCTTTAATTGT
TGCTTTTACGGTGATATTGTGCATGCAAACCAGGAGCATTTTGTGTCTTAAGAAAAATAATCTTAGAACA
GATGGCTGTGAAAATTACACCCATGCACAGAACAAGCCACAGGAATAATAGTTCAGGATTTGGTTTTTCT
CTTTTTCTTGTAAACCTGGAGGGTTGATATATTCTTTCCATGCAGTTATTAGAACTTAGTTTTGTTCCAA
CAGTTAAACTTGCAATGAAAAGAAAATGTGCCATTTTTTTCACTCAGAATTATTCATAGCTGTATATTTG
AAACTGCTAATTACACACGTGTGATGTATGTTGGTTTTTTAGTGCAATTTCTTCTGTAGCTATTCTTTGA
CCAAACTGTGGGTATTGTTAATATTAATTTATATTTGTCTCATTTTGTATGTATGTGTAGTGTGTTTGTG
AGTATGTGTGGTTTATAATCTGACAAAGTCATGAAGCTCAGTTTGGCTGTAATTTAATTCCCCTTCCCTT
ATTTTTATTTATTTTTGTACTGTGCTGATTCAATAAAATGCACTGACCATCCATAAAAAAAAAAAAAAA


5' Read Nucleotide Sequence
>OriGene 5' read for BC035448 unedited
GGTGCACCATTTTGTAATACGACTCACTATAGGGCGGCCGCGAATTCGGCACGAGGCCGC
CTGCACCCCCGGCCAGCCAGCTCTCGGGTTCCCAGACCGGGGGCTCCTCCTCAGTCAAGA
AAGCCCCTCACCCTGCCGTCACCTCCGCAGGGACGCCCAAACGGGTCATCGTCCAGGCGT
CCACCAGTGAGCTGCTTCGCTGCCTGGGTGAGTTTCTCTGCCGCCGGTGCTACCGCCTGA
AGCACCTGTCCCCCACGGACCCCGTGCTCTGGCTGCGCAGCGTGGACCGCTCGCTGCTTC
TGCAGGGCTGGCAGGACCAGGGCTTCATCACGCCGGCCAACGTGGTCTTCCTCTACATGC
TCTGCAGGGATGTTATCTCCTCCGAGGTGGGCTCGGATCACGAGCTCCAGGCCGTCCTGC
TGACATGCCTGTACCTCTCCTACTCCTACATGGGCAACGAGATCTCCTACCCGCTCAAGC
CCTTCCTGGTGGAGAGCTGCAAGGAGGCCTTTTGGGACCGTTGCCTCTCTGTCATCAACC
TCATGAGCTCAAAGATGCTGCAGATAAATGCCGACCCACACTACTTCACACAGGTCTTCT
CCGACCTGAAGAACGAGAGCGGCCAGGAGGACAAGAAGCGGCTCCTCCTANGCCTGGATC
GGTGAGCACTGTAGCCTGCGTCATGGCTCAAGGATTCAATGCATNTTTAAGAATNTATTA
TTAAATCAGTTTTGTGTACAGTATGTGTCTAGCAAAGCCACCAAAGGCCTCACCTTNTCC
ACAGTCTCTCCCTGGGGTTTTTTTCATTCCTGCCAAGAACTCTGGGCACTTTTGAACTCA
CGAGCCTTGCGCAAAAACCAGAAGATGTATNCAGAAGCCACCAGGCCACTGACCTCCCAC
TTTGGGGACTCAAAGACCTGACTGCC
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN BC035448
ORF Size 3149 bp
Insert Size 3800
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq Size 3149
RefSeq ORF 3149
Locus ID 8851
Cytogenetics 17q11.2
Protein Families Druggable Genome
Protein Pathways Alzheimer's disease
Gene Summary The protein encoded by this gene (p35) is a neuron-specific activator of cyclin-dependent kinase 5 (CDK5); the activation of CDK5 is required for proper development of the central nervous system. The p35 form of this protein is proteolytically cleaved by calpain, generating a p25 form. The cleavage of p35 into p25 results in relocalization of the protein from the cell periphery to nuclear and perinuclear regions. P25 deregulates CDK5 activity by prolonging its activation and changing its cellular location. The p25 form accumulates in the brain neurons of patients with Alzheimer's disease. This accumulation correlates with an increase in CDK5 kinase activity, and may lead to aberrantly phosphorylated forms of the microtubule-associated protein tau, which contributes to Alzheimer's disease. [provided by RefSeq, Jul 2008]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.