Laminin(LAMA1) (AK091949) Human Untagged Clone

CAT#: SC103296

(untagged)-Human cDNA FLJ34630 fis, clone KIDNE2015546, highly similar to LAMININ ALPHA-1 CHAIN PRECURSOR

USD 618


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Laminin(LAMA1) (AK091949) Human Untagged Clone
Symbol LAMA1
Vector pCMV6-XL4
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC103296 sequence for AK091949 edited (data generated by NextGen Sequencing)
ATGCTGATCGGAGGCAACATTGAGGTACATGTCAATCCTGGGGATGGGACAGGCCTGAGA
AAAGCTCTCCTGCACGCTCCCACGGGTACCTGCAGTGATGGACAAGCGCATTCCATCTCC
TTGGTCAGGAATCGGAGAATTATCACTGTCCAATTGGATGAGAACAATCCTGTGGAAATG
AAGTTGGGCACATTAGTAGAAAGCAGGACGATAAATGTGTCCAATCTGTACGTCGGGGGA
ATTCCAGAGGGAGAGGGGACGTCACTGCTCACAATGAGAAGATCGTTCCATGGCTGTATC
AAAAACCTGATCTTCAATTTGGAACTTTTGGATTTCAACAGTGCAGTTGGCCATGAGCAA
GTCGACCTGGACACCTGCTGGCTGTCAGAAAGGCCTAAGCTGGCTCCCGATGCAGAGGAC
AGCAAGCTCTTGCCAGAGCCCCGGGCTTTTCCAGAACAGTGTGTGGTGGATGCAGCTCTG
GAGTACGTTCCCGGCGCTCACCAGTTTGGTCTCACACAAAACAGCCATTTCATCTTGCCT
TTTAATCAGTCGGCTGTCAGAAAGAAGCTCTCGGTTGAGCTAAGCATCCGCACGTTCGCC
TCCAGCGGCCTGATTTACTACATGGCTCATCAGAACCAAGCAGACTACGCTGTGCTCCAG
CTGCACGGGGGCCGCCTCCACTTCATGTTTGACCTTGGCAAAGGCAGAACAAAGGTCTCT
CACCCTGCACTGCTCAGTGATGGCAAGTGGCACACGGTCAAGACAGACTATGTTAAAAGA
AAAGGCTTCATAACTGTCGACGGCCGAGAGTCTCCCATGGTGACTGTGGTGGGAGATGGA
ACCATGCTGGATGTGGAGGGTTTGTTCTACCTAGGAGGCCTGCCCTCCCAGTACCAGGCC
AGGAAAATTGGAAATATCACCCACAGCATCCCTGCCTGCATTGGGGATGTGACGGTTAAC
AGCAAACAGCTGGACAAGGACAGCCCGGTGTCTGCCTTCACGGTGAACAGGTGCTACGCA
GTGGCCCAGGAAGGAACATACTTTGACGGAAGCGGATATGCAGCTCTTGTCAAAGAGGGC
TACAAAGTCCAGTCAGATGTGAACATCACACTGGAGTTTCGAACCTCCTCGCAGAATGGC
GTCCTCCTGGGGATCAGCACTGCCAAAGTGGATGCCATTGGACTAGAGCTTGTGGACGGC
AAGGTCTTGTTCCATGTCAACAATGGTGCTGGCAGGATAACAGCTGCATATGAGCCCAAA
ACCGCCACTGTGCTCTGTGATGGAAAATGGCACACTCTTCAAGCTAACAAAAGCAAACAC
CGTATCACTCTGATTGTTGACGGGAACGCAGTTGGCGCTGAAAGTCCACACACCCAGTCT
ACCTCAGTGGACACCAACAATCCCATTTATGTTGGTGGCTATCCTGCTGGTGTGAAGCAA
AAATGCCTGCGCAGCCAGACCTCGTTCCGCGGGTGTTTGAGGAAGCTAGCTCTGATTAAG
AGCCCGCAGGTGCAGTCCTTTGACTTCAGCAGAGCGTTCGAACTGCACGGAGTTTTCCTT
CATTCCTGTCCTGGGACNGAGTCCTGA

Clone variation with respect to AK091949.1
1450 t=>c;1578 c=>n
5' Read Nucleotide Sequence
>OriGene 5' read for AK091949 unedited
CCATATGGATCCGACTCACTATAGGGNNCGGCCGCGCAATTCGGCACGAGGGCTACATTG
AATTGCCACCCAAATCTTTGTCACCAGAATCAGAATGGCTGGTAACATTTGCCACCACGA
ACAGCAGTGGCATCATCCTGGCTGCCCTCGGCGGGGATGTGGAGAAGCGGGGTGACCGTG
AGGAAGCACACGTGCCCTTCTTTTCCGTCATGCTGATCGGAGGCAACATTGAGGTACATG
TCAATCCTGGGGATGGGACAGGCCTGAGAAAAGCTCTCCTGCACGCTCCCACGGGTACCT
GCAGTGATGGACAAGCGCATTCCATCTCCTTGGTCAGGAATCGGAGAATTATCACTGTCC
AATTGGATGAGAACAATCCTGTGGAAATGAAGTTGGGCACATTAGTAGAAAGCAGGACGA
TAAATGTGTCCAATCTGTACGTCGGGGGAATTCCAGAGGGAGAGGGGACGTCACTGCTCA
CAATGAGAAGATCGTTCCATGGCTGTATCAAAAACCTGATCTTCAATTTGGAACTTTTGG
ATTTCAACAGTGCAGTTGGCCATGAGCAAGTCGACCTGGACACCTGCTGGCTGTCAGAAA
GGCCTAAGCTGGCTCCCGATGCAGAGGACAGCAAGCTCTTGCCAGAGCCCCGGGCTTTTC
CAGAACAGTGTGTGGTGGATGCAGCTCTGGAGTACGTTCCCGGCGCTCACCAGTTTGGTC
TCACACAAAACAGCCATTTCATCTTGCCCTTTAATCAGTCGGCTGTCAGAAAAGAGCTCT
CGGTTGAGCTAAGCATCCGCACGTTCGCCTCCAGCGGNCCTGATTACTACATGGCTCATC
AGAACCAAGCAGACTACGCTGTGCTCCAGCTGCACGGGGGCCGCCTNCACTTCATGTTTG
ACCTTNGGCAAGCAGAACAAGGTCTCTCACCTGCACTGCTCANTGATGGCCAGTGCACAC
GTCAAGACNGACTATGTAAAGAAAAGCTNCATACTGTCGACGCCGAG
3' Read Nucleotide Sequence
>OriGene 3' read for AK091949 unedited
NNGGGTTTGCTCCTGTTTTGGTACTTTTTTAAAAGCTCAAATGNAAAAACATAAAATACT
ATCAAGTAATCAACAGAACATTCAATGTGTATAAAGATTTTTTTAAAAATACGTTTAAAA
AGAGAGCCAGGGAATTCAATTTACATTTTAGACCATTTAATGGAGGTATTTGTTGCACAT
GTGGTTTTAGTGTAACGTAAACACAACATCTCTCCCCAGAAACACTTAACCTGAGTTGGA
AATGAAATATGAACTGAAGAGATTCTTAATTCACACATACACTTCTCCTCAAAATATTAG
CAATGATTCCAACTGAGGATTCTGCTTGAAGTTCAGGACTCGGTCCCAGGACAGGAATGA
AGGAAAACTCCGTGCAGTTCGAACGCTCTGCTGAAGTCAAAGGACTGCACCTGCGGGCTC
TTAATCAGAGCTAGCTTCCTCAAACACCCGCGGAACGAGGTCTGGCTGCGCAGGCATTTT
TGCTTCACACCAGCAGGATAGCCACCAACATAAATGGGATTGTTGGTGTCCACTGAGGTA
GACTGGGTGTGTGGACTTTCAGCGCCAACTGCGTTCCCGTCAACAATCAGAGTGATACGG
TGTTTGCTTTTGTTAGCTTGAAGAGTGTGCCATTTTCCATCACAGAGCACAGTGGCGGTT
TTGGGCTCATATGCAGCTGTTATCCTGCCAGCACCATTGTTGACATGGAACAAGACCTTG
CCGTCCACAAGCTCTAGTCCAATGGCATCCACTTTGGCAGTGCTGATCCCCAGGAGGACG
CCATTCTGCGAGGAGGTTCGAAACTCCAGTGTGATGTTCACATCTGACTGGACTTGTAGC
CCTCTTTTGACAGAGCTGCCTATCCGCTTCCGTCAAAGTATGGTTCCTTCCTGGGCCACT
GCGTTACAC
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN AK091949
ORF Size 1587 bp
Insert Size 2200
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq Size 2825
RefSeq ORF 1587
Locus ID 284217
Cytogenetics 18p11.31
Domains LamG
Protein Families ES Cell Differentiation/IPS, Druggable Genome
Protein Pathways Focal adhesion, ECM-receptor interaction, Pathways in cancer, Small cell lung cancer
Gene Summary Binding to cells via a high affinity receptor, laminin is thought to mediate the attachment, migration and organization of cells into tissues during embryonic development by interacting with other extracellular matrix components. [UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.