GLUR3(GRIA3) (BC032004) Human Untagged Clone

CAT#: SC103207

GRIA3 (untagged)-Homo sapiens, Similar to glutamate receptor, ionotrophic, AMPA 3, clone IMAGE:4753474

USD 618


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name GLUR3(GRIA3) (BC032004) Human Untagged Clone
Symbol GRIA3
Synonyms GLURC;GLUR-C; GLUR-K3; GLUR3; MRX94; OTTHUMP00000024261; OTTHUMP00000024262; dJ1171F9.1; glutamate receptor C; glutamate receptor subunit 3; glutamate receptor, ionotrophic, AMPA 3
Vector pCMV6-XL4
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for BC032004, the custom clone sequence may differ by one or more nucleotides


ATGGCCAGGCAGAAGAAAATGGGGCAAAGCGTGCTCCGGGCGGTCTTCTTTTTAGTCCTGGGGCTTTTGG
GTCATTCTCACGGAGGATTCCCCAACACCATCAGCATAGGTGGACTTTTCATGAGAAACACAGTGCAGGA
GCACAGCGCTTTCCGCTTTGCCGTGCAGTTATACAACACCAACCAGAACACCACCGAGAAGCCCTTCCAT
TTGAATTACCACGTAGATCACTTGGATTCCTCCAATAGTTTTTCCGTGACAAATGCTTGTCCTGCTGAAA
GGGACTACCTGCCTTGGCCAGGAAGCATCAGGGAAAACAATTGGACAGCTCTGCCGTGCTGCAAAGATCA
TGGGCTGCTGCACCTAAAATGTTCACCAGGTGGGGCCCGCCAAAACTGGGCCTATTGTATCTGGGGCGTT
ACAGGTGAACTGTAA


5' Read Nucleotide Sequence
>OriGene 5' read for BC032004 unedited
GTGTCAAAATTTGTATACGACTCACTATAGGCGGCCGCGAATTCGCACGAGGGGGAGAGA
GAGGGAGCAAGAAAGGAAGAGAGAGCGAGCGAGAGAGAGCGAGCGAATAAGAGAGAGAGT
AAGAGGGAGAGAGAAGAAGAGGAAGAAGAGGAGGCGGCGGCAGCGGAGGAGGAGGAGGAC
TAGTGTGGGGTGGAAAGGAAGAGTGAGCGAGAGCAAGTTAAGGGGAGGGGGTGTAAGAGC
CAGCGAATTCTTTTTCTTTTTCTATTATTATTTTGACGACTCCTGAGTTGCGCCCATGCT
CTTGTCAGCTTCGTTTTAGGCGTAGCATGGCCAGGCAGAAGAAAATGGGGCAAAGCGTGC
TCCGGGCGGTCTTCTTTTTAGTCCTGGGGCTTTTGGGTCATTCTCACGGAGGATTCCCCA
ACACCATCAGCATAGGTGGACTTTTCATGAGAAACACAGTGCAGGAGCACAGCGCTTTCC
GCTTTGCCGTGCAGTTATACAACACCAACCAGAACACCACCGAGAAGCCCTTCCATTTGA
ATTACCACGTAGATCACTTGGATTCCTCCAATAGTTTTTCCGTGACAAATGCTTTCTGCT
CCCAGTTCTCGAGAGGGGTGTATGCCATCTTTGGATTCTATGACCAGATGTCAATGAACA
CCCTGACCTCCTTCTGTGGGGCCCTGCCACATCCTTTGTTACGCCTAGCTTCCCCACTGA
CGCAGATGTGCAGTTTGTCATCCAGATGCGCCCAGCCTTGAAGGGCGCTATTCTGAGTCT
TCTGGGTCATTACAAGTGGGAGAAAGTTTGTGTACCTCTATGACACAGAAACGAGGATTT
TCCATTCTNNCAGCGATTATGGAAGCAGCAGTGCAAAACAACTGGNNCAGTACAGCNAGG
GTCTGTGGGAAACATAAAAGGACGTNCCAGNATTCANGCGCATCATTGNAG
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN BC032004
ORF Size 1011 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq BC032004.1, AAH32004
RefSeq Size 1011
RefSeq ORF 1011
Locus ID 2892
Cytogenetics Xq25
Protein Families Transmembrane, Ion Channels: Glutamate Receptors, Druggable Genome
Protein Pathways Neuroactive ligand-receptor interaction, Long-term depression
Gene Summary Glutamate receptors are the predominant excitatory neurotransmitter receptors in the mammalian brain and are activated in a variety of normal neurophysiologic processes. These receptors are heteromeric protein complexes composed of multiple subunits, arranged to form ligand-gated ion channels. The classification of glutamate receptors is based on their activation by different pharmacologic agonists. The subunit encoded by this gene belongs to a family of AMPA (alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate)-sensitive glutamate receptors, and is subject to RNA editing (AGA->GGA; R->G). Alternative splicing at this locus results in different isoforms, which may vary in their signal transduction properties. [provided by RefSeq, Jul 2008].
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.