Tropomyosin 3(TPM3) (XM_085393) Human Untagged Clone

CAT#: SC102192

(untagged)-Human similar to gelatinase A (EC 3.4.24.24) precursor - Human (LOC146253)

USD 618.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Tropomyosin 3(TPM3) (XM_085393) Human Untagged Clone
Symbol TPM3
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for XM_085393, the custom clone sequence may differ by one or more nucleotides


ATGATGCAGAGGAGCGAGCTGAGCGCCTCCAGCAAGAAGTTGAGGGAGAAAGGCGGGCCCGGAAACAGAG
GTATGAAGGTTATTGAAAACCGGGCTTTAAAAGATGAAGAAAAGATGGAACTCCAAGAACTCCAACTCAA
AGAAGCTAAGCACATTGCAGAAGAGGCAGATAGGAAGTATGAAGAGGTGGCTCGTAAGTTGGTGACCATT
GAAGGAGACTTGGAACGCACAGAGGAACGAGCTGAGCTGACAGAGTCCCGTTGCCGAGAGATGGATGAGC
AGATTAGACTGATGGACCAGAACCTGAAGTGTCTGAGTGCTGCTGAAGAAAAGTACTCTCAAAAAGAAGA
CAAATATGAGGAAGAAATCAAGATTTTTACTGATAAACCCAAGGAGGCAGAGACCTGTGCTGAGTTTGCT
GAGCGATCGGTAGCCAAGCTGGAAAAGACAATTGATGACTTGGAAGATAAACTGAAATGCACCAAAGAGG
AGCACCTCTGTACACAAAGGATGCTGGACCAGACTCTGCTTGACCTGAATGAGATGTAG


5' Read Nucleotide Sequence
>OriGene 5' read for XM_085393 unedited
TTCCTATTATGTAATACGACTCACTATAGGGCGGCCGCGAAATTCGCACGAGGGCAACGC
CGAGCGGAGGAGGCAGGAACCGGAGCGCGAGCAGTAGCTGGGTGGGCACCATGGCTGGGA
TCACCACCATCGAGGCGGTGAAGCGCAAGATCCAGGTTCTGCAGCAGCAGGCAGATGATG
CAGAGGAGCGAGCTGAGCGCCTCCAGCGAGAAGTTGAGGGAGAAAGGCGGGCCCGGGAAC
AGGCTGAGGCTGAGGTGGCCTCCTTGAACCGTAGGATCCAGCTGGTTGAAGAAGAGCTGG
ACCGTGCTCAGGAGCGCCTGGCCACTGCCCTGCAAAAGCTGGAAGAAGCTGAAAAAGCTG
CTGATGAGAGTGAGAGAGGTATGAAGGTTATTGAAAACCGGGCCTTAAAAGATGAAGAAA
AGATGGAACTCCAGGAAATCCAACTCAAAGAAGCTAAGCACATTGCAGAAGAGGCAGATA
GGAAGTATGAAGAGGTGGCTCGTAAGTTGGTGATCATTGAAGGAGACTTGGAACGCACAG
AGGAACGAGCTGAGCTGGCAGAGTCTAAGTGTTCTGAGCTGGAGGAGGAGCTGAAGAATG
TCACCAACAACCTCAAGTCTCTTGAGGCTCANGCGGAGAAGTACTCTCAAAAAGAAGATA
AATATGAGGAAGAAATCAAGATTCTTACTGATTAACTCAAGGAGGCAGAGACCCCGTGCT
GAGTTTGCTGAAAGATCGGTAGCCAAGCTGGAAAAGACAATTGATGACCTCGAAGAAAAA
CCTGAATGCCCCAAAGAGAGCACCTCTGTCACAAAAGATGCTGGACCACACCCTGCTTGA
CCTGAAGGAAAGTTATAACGCCCCATTCCCACCTTGTGTTGTTTCTCCTTTTGACCAAAC
TCCGCCTGAGGCANCCCGGGGAAAACTGACCTTTAACTGAGGCTGAATTTTAACTGTAAG
CGTGTTTTTCT
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN XM_085393
ORF Size 549 bp
Insert Size 2250
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq Size 797
Locus ID 7170
Cytogenetics 1q21.3
Domains Tropomyosin
Protein Pathways Cardiac muscle contraction, Pathways in cancer, Thyroid cancer, Hypertrophic cardiomyopathy (HCM), Dilated cardiomyopathy
Gene Summary This gene encodes a member of the tropomyosin family of actin-binding proteins. Tropomyosins are dimers of coiled-coil proteins that provide stability to actin filaments and regulate access of other actin-binding proteins. Mutations in this gene result in autosomal dominant nemaline myopathy and other muscle disorders. This locus is involved in translocations with other loci, including anaplastic lymphoma receptor tyrosine kinase (ALK) and neurotrophic tyrosine kinase receptor type 1 (NTRK1), which result in the formation of fusion proteins that act as oncogenes. There are numerous pseudogenes for this gene on different chromosomes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2013].
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.