HLAA(HLA-A) (XM_175163) Human Untagged Clone

CAT#: SC102132

(untagged)-Human similar to MHC class I A (LOC257490)

USD 618


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name HLAA(HLA-A) (XM_175163) Human Untagged Clone
Symbol HLA-A
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for XM_175163, the custom clone sequence may differ by one or more nucleotides


ATGCTGATCCACCATTCCGTCTCTGACTATAAGGCCACCCTGAGGTGCTGGGCCCTGGGCTTCTACCCTG
TGGAGATCACACTGGCCTGGCAGCAGGATGGAGAGGACCAGACTCGGGACATGGAGCTTCTAGAGACCAG
GCCTGCAGGGGATGGAACCTTCCAGAAGTGGGCAGCTGTGGTGGTGCCTTCTGGAGAGGAACAGAGATAC
CCGTGCCATGTGCAGCATGAGGGGTTGCCCAAGCCCCTCACCCTGAGATGGGAGCAGTCTTCTCAGCCCA
CCATCCCCATCGTGGGTATCGTTGCTGGCCTGGTTCTCCTTGGAGCTGTAGTCACTGGAGCTGTGGTTTC
TGCTGTGATGTGCAGGAAGAAGAACTCAGATAGAGTGAGCTACTCTGAAGCTGCAAGCAGCGACCATGCG
CAGGGTTCTGATGTGTCTCTCACGGCTTGTAAAGTGTGA


5' Read Nucleotide Sequence
>OriGene 5' read for XM_175163 unedited
NGTAACGTCAAAATTTGTATACGACTCACTATAGGCGGCCGCGAATTCGCACGAGGGAAA
TTTTCCACGGATAGGAGATTATCCCAGGTACCTGTGTCCAGGCTGGTGTCTGGGTTCTGT
GCTCCCTTCCCCACCCCAGGTGTCCTGTCCATTCTCAGGATGGCCACATGCGTGCTGCTG
GAGTGTCTCATGAGAGATGCAAAGTGCCTGAATTTTCTGACTCTTCCTGTTAGACACCCC
CCCCCGGCAAGACACATATGATCCACCATTCCATCTCTGACTATAAGGCCACCCTGAGGT
GCTGGGCCCTGGGCTTCTACCCTATGGAGATCACACTGAGCTGGCAGCAGGATGAAGAGG
ACCAGACTCGGGACATGGAGCTTGTAGAGACCAGGCCTGCAGGGGATGGAACCTTCCAGA
AGTGGGCAGCTGTGGTGGTGCCTTCTGGAGAGGAACAGATACATGTGCCATGTGCAGCAT
GAGGGGTTGCCCGAGCCCCTCACCCTGAGATGGGGTAAGGCAAGAGATTAGTGGAGGGGG
GGTCATGTCTCTTAGGTAAAGCAGGAGCCTCTCTGGAGAACTTCAGCAGGGTCGGTGCTG
GGGGCTGAGGGTCAGGGACGCTCACCTTCCCCTTTTTTCCCAGAGCAGTCTTCTCAGCCC
ACCATCCCCATCGTGGGCATCGTTACTGGCCTGGTTCTCCTTGGAGCTGTAGTCACTGGA
GCTGTGGTTTCTGCTGTGATGTGCAGGAAGAAGAACTCAGATAGAGTGAGCTACTCTGAA
GCTGCAAGCAGCGACCATGCGCCAGGTTCTGATGTGTCTCTCACGGCTTGTAAAGGTGAG
ACGCTGGGGGACCTGATGTGTGGGGGGGTTTGGGGGCAATAGTGGA
3' Read Nucleotide Sequence
>OriGene 3' read for XM_175163 unedited
NNTTTCGGTACGACCATGNNACCGCGGCCGCAANCTAGNGATCGATTTTTTTTTTTTTTT
TTTGTGGACTCTGGNAAGTTCTCATGTCTTCCATTTATTTTGTCTCTCAAATTTTAGGAA
TCTTCTCCTTTAATTAACCCATCAACCTCTCATGGCAAGAATTTGAAAAAGTAAATTTAT
ACTCAGATTCTAATTTTAATAGGGAAGTAAGAAGTTACAGCTCAGTGCACATAAAGTTGA
GACAGAGATGGAGACATCTCAGCCTCACCTCTGTGGAGCAGGAATGATTAATTATTGGAG
AGGGAACACAGGTCAGCATGAGGGAAGAGGATCATGGTGGACATGGGGGTGGGTTGGTCT
CCCCACCTCCTCATATTATGCCTACAGGAACACAGGCACATTCAGGTGCCTTTGCAGAAA
GTGAGTCAGGGTTTTTGAAGTCACAAAGGGAAGGCATGAACAAATCTTGCCTCTCAGTCC
CACACAAGGCAGCTGTCTCACACTATAAAATAAAATATTCATGAACAAATTCATATCCGT
CACAGTGAGGGATGACACTTTAAACAGCCCATCACATGTTCAATACATCCAATTCAAAGA
AACCCCATAGCACAGCTGCATCCACTATTGCCCCCAACACCCCCCACACATCAAGTCCCC
CCGCGTCTCCCCTTTACAAGCCGTGAGAGACACATCAAAACCCTGCGCATGGTCCCTGCT
TGCACCTTCACAATAACTCACTCTATCTGAGTTCTTCTTCCTGCCCATACAGCAGAAACC
CCAGCTCCCGTGACCTCCCCCTCCAGGAGAAACCGGCCCAGTAACGAGGCCCCACAAGGG
GATGGGGGGCCTGAAAAAACTGCTCTGGGGAAAAAGGGGAAGGG
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN XM_175163
ORF Size 459 bp
Insert Size 1500
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq Size 1102
RefSeq ORF 459
Locus ID 3105
Cytogenetics 6p22.1
Protein Families Transmembrane
Protein Pathways Endocytosis, Cell adhesion molecules (CAMs), Antigen processing and presentation, Natural killer cell mediated cytotoxicity, Type I diabetes mellitus, Autoimmune thyroid disease, Allograft rejection, Graft-versus-host disease, Viral myocarditis
Gene Summary HLA-A belongs to the HLA class I heavy chain paralogues. This class I molecule is a heterodimer consisting of a heavy chain and a light chain (beta-2 microglobulin). The heavy chain is anchored in the membrane. Class I molecules play a central role in the immune system by presenting peptides derived from the endoplasmic reticulum lumen. They are expressed in nearly all cells. The heavy chain is approximately 45 kDa and its gene contains 8 exons. Exon 1 encodes the leader peptide, exons 2 and 3 encode the alpha1 and alpha2 domains, which both bind the peptide, exon 4 encodes the alpha3 domain, exon 5 encodes the transmembrane region, and exons 6 and 7 encode the cytoplasmic tail. Polymorphisms within exon 2 and exon 3 are responsible for the peptide binding specificity of each class one molecule. Typing for these polymorphisms is routinely done for bone marrow and kidney transplantation. Hundreds of HLA-A alleles have been described. [provided by RefSeq, Jul 2008].
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.