CD8A (NM_171827) Human Untagged Clone

CAT#: SC101240

CD8A (untagged)-Human CD8a molecule (CD8A), transcript variant 2

USD 402.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name CD8A (NM_171827) Human Untagged Clone
Symbol CD8A
Synonyms CD8; Leu2; MAL; p32
Vector pCMV6-XL4
Sequence Data
Fully Sequenced ORF
>OriGene ORF sequence for NM_171827 edited
ATGGCCTTACCAGTGACCGCCTTGCTCCTGCCGCTGGCCTTGCTGCTCCACGCCGCCAGG
CCGAGCCAGTTCCGGGTGTCGCCGCTGGATCGGACCTGGAACCTGGGCGAGACAGTGGAG
CTGAAGTGCCAGGTGCTGCTGTCCAACCCGACGTCGGGCTGCTCGTGGCTCTTCCAGCCG
CGCGGCGCCGCCGCCAGTCCCACCTTCCTCCTATACCTCTCCCAAAACAAGCCCAAGGCG
GCCGAGGGGCTGGACACCCAGCGGTTCTCGGGCAAGAGGTTGGGGGACACCTTCGTCCTC
ACCCTGAGCGACTTCCGCCGAGAGAACGAGGGCTACTATTTCTGCTCGGCCCTGAGCAAC
TCCATCATGTACTTCAGCCACTTCGTGCCGGTCTTCCTGCCAGCGAAGCCCACCACGACG
CCAGCGCCGCGACCACCAACACCGGCGCCCACCATCGCGTCGCAGCCCCTGTCCCTGCGC
CCAGAGGCGTGCCGGCCAGCGGCGGGGGGCGCAGGGAACCGAAGACGTGTTTGCAAATGT
CCCCGGCCTGTGGTCAAATCGGGAGACAAGCCCAGCCTTTCGGCGAGATACGTCTAA
5' Read Nucleotide Sequence
>OriGene 5' read for NM_171827 unedited
CCCCCGTTAGAAATTTGTATACGACTCATATAGGCGGCCTGCGAATCGGCACCAGGAAGC
CAGCAGCGTCCTGGGGAGCGCGTCATGGCCTTACCAGTGACCGCCTTGCTCCTGCCGCTG
GCCTTGCTGCTCCACGCCGCCAGGCCGAGCCAGTTCCGGGTGTCGCCGCTGGATCGGACC
TGGAACCTGGGCGAGACAGTGGAGCTGAAGTGCCAGGTGCTGCTGTCCAACCCGACGTCG
GGCTGCTCGTGGCTCTTCCAGCCGCGCGGCGCCGCCGCCAGTCCCACCTTCCTCCTATAC
CTCTCCCAAAACAAGCCCAAGGCGGCCGAGGGGCTGGACACCCAGCGGTTCTCGGGCAAG
AGGTTGGGGGACACCTTCGTCCTCACCCTGAGCGACTTCCGCCGAGAGAACGAGGGCTAC
TATTTCTGCTCGGCCCTGAGCAACTCCATCATGTACTTCAGCCACTTCGTGCCGGTCTTC
CTGCCAGCGAAGCCCACCACGACGCCAGCGCCGCGACCACCAACACCGGCGCCCACCATC
GCGTCGCAGCCCCTGTCCCTGCGCCCAGAGGCGTGCCGGCCAGCGGCGGGGGGCGCTAGG
GAACCGAAGACGTGTTTGCAAATGTCCCCGGCCTGTGGTCAAATCGGGAGACAAGCCCAG
CCTTTCGGCGAGATACGTCTAACCCTGTGCAACAGCCACTACATTACTTCAAACTGAGAT
CCTTCCTTTTGAGGGAGCACGNCCTTCCCTTTCATTNTTTCCAGNCTTCCTCCCTGTGTA
TTCATTCTCATGAGTATTATTTTCATGGGGGCGGGNGGGGGCAAAGCCTACCTTTTCCTT
TATGTGTTTGACGGGCAAACAAACTAGGGTAAATCTACAGTCACCACCAGG
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_171827
ORF Size 597 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_171827.1, NP_741969
RefSeq Size 2150
Locus ID 925
Cytogenetics 2p11.2
Protein Families Secreted Protein, ES Cell Differentiation/IPS, Transmembrane, Adult stem cells, Druggable Genome
Protein Pathways Cell adhesion molecules (CAMs), Antigen processing and presentation, Hematopoietic cell lineage, T cell receptor signaling pathway, Primary immunodeficiency
Gene Summary The CD8 antigen is a cell surface glycoprotein found on most cytotoxic T lymphocytes that mediates efficient cell-cell interactions within the immune system. The CD8 antigen acts as a coreceptor with the T-cell receptor on the T lymphocyte to recognize antigens displayed by an antigen presenting cell in the context of class I MHC molecules. The coreceptor functions as either a homodimer composed of two alpha chains or as a heterodimer composed of one alpha and one beta chain. Both alpha and beta chains share significant homology to immunoglobulin variable light chains. This gene encodes the CD8 alpha chain. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2011].
Transcript Variant: This variant (2) lacks an alternate in-frame exon compared to variant 1. The resulting protein (isoform 2) lacks an internal segment including the transmembrane domain compared to isoform 1, resulting in a secreted protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations