NFAT2(NFATC1) (NM_172390) Human Untagged Clone

CAT#: SC101076

NFATC1 (untagged)-Human nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 1 (NFATC1), transcript variant 1

USD 721


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name NFAT2(NFATC1) (NM_172390) Human Untagged Clone
Symbol NFATC1
Synonyms NF-ATC; NF-ATc1.2; NFAT2; NFATc
Vector pCMV6-XL6
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC101076 sequence for NM_172390 edited (data generated by NextGen Sequencing)
ATGCCAAGCACCAGCTTTCCAGTCCCTTCCAAGTTTCCACTTGGCCCTGCGGCTGCGGTC
TTCGGGAGAGGAGAAACTTTGGGGCCCGCGCCGCGCGCCGGCGGCACCATGAAGTCAGCG
GAGGAAGAACACTATGGCTATGCATCCTCCAACGTCAGCCCCGCCCTGCCGCTCCCCACG
GCGCACTCCACCCTGCCGGCCCCGTGCCACAACCTTCAGACCTCCACACCGGGCATCATC
CCGCCGGCGGATCACCCCTCGGGGTACGGAGCAGCTTTGGACGGTGGGCCCGCGGGCTAC
TTCCTCTCCTCCGGCCACACCAGGCCTGATGGGGCCCCTGCCCTGGAGAGTCCTCGCATC
GAGATAACCTCGTGCTTGGGCCTGTACCACAACAATAACCAGTTTTTCCACGATGTGGAG
GTGGAAGACGTCCTCCCTAGCTCCAAACGGTCCCCCTCCACGGCCACGCTGAGTCTGCCC
AGCCTGGAGGCCTACAGAGACCCCTCGTGCCTGAGCCCGGCCAGCAGCCTGTCCTCCCGG
AGCTGCAACTCAGAGGCCTCCTCCTACGAGTCCAACTACTCGTACCCGTACGCGTCCCCC
CAGACGTCGCCATGGCAGTCTCCCTGCGTGTCTCCCAAGACCACGGACCCCGAGGAGGGC
TTTCCCCGCGGGCTGGGGGCCTGCACACTGCTGGGTTCCCCGCGGCACTCCCCCTCCACC
TCGCCCCGCGCCAGCGTCACTGAGGAGAGCTGGCTGGGTGCCCGCTCCTCCAGACCCGCG
TCCCCGTGCAACAAGAGGAAGTACAGCCTCAACGGCCGGCAGCCGCCCTACTCACCCCAC
CACTCGCCCACGCCGTCCCCGCACGGCTCCCCGCGGGTCAGCGTGACCGACGACTCGTGG
TTGGGCAACACCACCCAGTACACCAGCTCGGCCATCGTGGCCGCCATCAACGCGCTGACC
ACCGACAGCAGCCTGGACCTGGGAGATGGCGTCCCTGTCAAGTCCCGCAAGACCACCCTG
GAGCAGCCGCCCTCAGTGGCGCTCAAGGTGGAGCCCGTCGGGGAGGACCTGGGCAGCCCC
CCGCCCCCGGCCGACTTCGCGCCCGAAGACTACTCCTCTTTCCAGCACATCAGGAAGGGC
GGCTTCTGCGACCAGTACCTGGCGGTGCCGCAGCACCCCTACCAGTGGGCGAAGCCCAAG
CCCCTGTCCCCTACGTCCTACATGAGCCCGACCCTGCCCGCCCTGGACTGGCAGCTGCCG
TCCCACTCAGGCCCGTATGAGCTTCGGATTGAGGTGCAGCCCAAGTCCCACCACCGAGCC
CACTACGAGACGGAGGGCAGCCGGGGGGCCGTGAAGGCGTCGGCCGGAGGACACCCCATC
GTGCAGCTGCATGGCTACTTGGAGAATGAGCCGCTGATGCTGCAGCTTTTCATTGGGACG
GCGGACGACCGCCTGCTGCGCCCGCACGCCTTCTACCAGGTGCACCGCATCACAGGGAAG
ACCGTGTCCACCACCAGCCACGAGGCCATCCTCTCCAACACCAAAGTCCTGGAGATCCCA
CTCCTGCCGGAGAACAGCATGCGAGCCGTCATTGACTGTGCCGGAATCCTGAAACTCAGA
AACTCCGACATTGAACTTCGGAAAGGAGAGACGGACATCGGGAGGAAGAACACACGGGTA
CGGCTGGTGTTCCGCGTTCACGTCCCGCAACCCAGCGGCCGCACGCTGTCCCTGCAGGTG
GCCTCCAACCCCATCGAATGCTCCCAGCGCTCAGCTCAGGAGCTGCCTCTGGTGGAGAAG
CAGAGCACGGACAGCTATCCGGTCGTGGGCGGGAAGAAGATGGTCCTGTCTGGCCACAAC
TTCCTGCAGGACTCCAAGGTCATTTTCGTGGAGAAAGCCCCAGATGGCCACCATGTCTGG
GAGATGGAAGCGAAAACTGACCGGGACCTGTGCAAGCCGAATTCTCTGGTGGTTGAGATC
CCGCCATTTCGGAATCAGAGGATAACCAGCCCCGTTCACGTCAGTTTCTACGTCTGCAAC
GGGAAGAGAAAGCGAAGCCAGTACCAGCGTTTCACCTACCTTCCCGCCAACGGTAACGCC
ATCTTTCTAACCGTAAGCCGTGAACATGAGCGCGTGGGGTGCTTTTTCTAA

Clone variation with respect to NM_172390.1
786 t=>g
5' Read Nucleotide Sequence
>OriGene 5' read for NM_172390 unedited
NGAAGGAAAAAGGCCCAACACCACCCCTTATACANNNNGTTTTTACACCCGCCCGTACCC
GCATAGGGCGGTAGGCGTGTCCGGTGGNGAGTCTATATAAGCAGAGCTCATTTAGGTGAC
ACTATAGAATACAAGCTACTTGTTCTTTTTGCAGCGGCCGCGAATTCGGCACGAGGAACT
CGCCGGCGGAGTCGCCGCGCCAGATCCCAGCAGCAGGGCGCGGGCACCGGGGCGCGGGCA
GGGCTCGGAGCCACCGCGCAGGTCCTAGGGCCGCGGCCGGGCCCCGCCACGCGCGCACAC
GCCCCTCGATGACTTTCCTCCGGGGCGCGCGGCGCTGAGCCCGGGGCGAGGGCTGTCTTC
CCGGAGACCCGACCCCGGCAGCGCGGGGCGCCCGCTTCTCCTGTGCCTCCGCCCGCCGCT
CCACTCCCCGCCGCCGCCGCGCGGATGCCAAGCACCAGCTTTCCAGTCCCTTCCAAGTTT
CCACTTGGCCCTGCGGCTGCGGTCTTCGGGAGAGGAGAAACTTTGGGGCCCGCGCCGCGC
GCCGGCGGCACCATGAAGTCAGCGGAGGAAGAACACTATGGCTATGCATCCTCCAACGTC
AGCCCCGCCCTGCCGCTCCCCACGGCGCACTCCACCCTGCCGGCCCCGTGCCACAACCTT
CAGACCTCCACACCGGGCATCATCCCGCCGGCGGATCACCCCTCGGNGTACGGAGCAGCT
NTGGACGGTGGGCCCGCGGGCTACTTCCTCTCCTCCGGCCACACCAGGCCTGATGGNGCC
CCTGCCCTGGAGAGTCCTCGCATCGAGATAACCTCGTGCTTGGGCCTGTACCACAACAAT
AACCAGTTNTTCCACGATGTGGNAGGTGGGAGACGTCCTCCCTAGCTCCAAACGGTCCCC
CTCCACGGCCACGCTGAATCTGCCCAA
3' Read Nucleotide Sequence
>OriGene 3' read for NM_172390 unedited
GAAAATCAGGTACCGTGCCGCAATCGAGGATTNGTTTTTTTTCTTTTTTTTTAAAAGCAA
AGTTTATTCCTAAAGTGCCTGCAAAATAGCTATACCTATTTGCCTTTTCACCGTAAGCAG
CTTTAGGGTGCAAATGCACACCAGGACCCCCTCAGTTTTTTGGAGCAGAAGAGCCATGTT
TTCCCCTTGGCTGTTATACATTCGCAAGAAGCAAAATATCCGTGACTATCTGAGTATGCA
ACCCCCGCCCCCCACCCCCAACAGGGATCAAGGAAAATGCATCCGAAGCTTCCCTTTTCC
TTTCCTTTTCAGGGCATCGATGGCTCGGTCTCACTAACGGGACATCACACAGTTAAATGT
GCAACACGCCACGCTGCTTTACGGCGACGTCGTTTCTGCGTCTTTAGAAAAAGCACCCCA
CGCGCTCATGTTCACGGCTTACGGTTAGAAAGATGGCGTTACCGTTGGCGGGAAGGTAGG
TGAAACGCTGGTACTGGCTTCGCTTTTTCTTCCCGTTGCAGACGTAGAAACTGACGTGAA
CGGGGCTGGGTATCCTCTGATTCCGAAATGGCGGGATCTCAACCACCAGAGAATTCCGCT
TGCACAAGGCCCGGGAAGTTTTCGCTTTCATCTCCCAGACATGGTGGCCATCTGGGGGCT
TTCTCACGAAAAATACCCTTGGAGTCCTCGCAGAAAGTTTTGGGCAGAAAAGACCATTTT
CTTTCCGCCCACGACCGGATAGCTGGCCGTGCTTTTGTTTTTCCACCAAAGCAGCTTCCT
GGACTTGAGCCTGGGAGCATTCGTTGGGGGTTGGAGGCCCCTCTGTGGGACAACTTTCCG
GCCCTTGTGTTGCGGGACCTTTACACCGGAAAACCAGCCGTCCCCGGGGGTTTTTTTTTC
CGATTGGGGTTTTTCTTTTCCAAGATAC
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_172390
ORF Size 2151 bp
Insert Size 2300
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_172390.1, NP_765978
RefSeq Size 3140
RefSeq ORF 2151
Locus ID 4772
Cytogenetics 18q23
Protein Families Transcription Factors, Druggable Genome
Protein Pathways Wnt signaling pathway, Axon guidance, VEGF signaling pathway, Natural killer cell mediated cytotoxicity, T cell receptor signaling pathway, B cell receptor signaling pathway
Gene Summary The product of this gene is a component of the nuclear factor of activated T cells DNA-binding transcription complex. This complex consists of at least two components: a preexisting cytosolic component that translocates to the nucleus upon T cell receptor (TCR) stimulation, and an inducible nuclear component. Proteins belonging to this family of transcription factors play a central role in inducible gene transcription during immune response. The product of this gene is an inducible nuclear component. It functions as a major molecular target for the immunosuppressive drugs such as cyclosporin A. Multiple alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. Different isoforms of this protein may regulate inducible expression of different cytokine genes. [provided by RefSeq, Jul 2013].
Transcript Variant: This variant (1) lacks two exons and its transcription extends past a splice site that is used in variant 6, which results in a novel 3' coding region and 3' UTR, compared to variant 6. The encoded isoform (A) is shorter and has a distinct C-terminus, compared to isoform F.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations