PPWD1 (NM_015342) Human Untagged Clone

CAT#: SC100850

Reviews ()
Write a review

PPWD1 (untagged)-Human peptidylprolyl isomerase domain and WD repeat containing 1 (PPWD1)



Reconstitution Protocol

USD 602.00

In Stock*

Size
    • 10 ug

Product images

Other products for "PPWD1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol PPWD1
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_015342, the custom clone sequence may differ by one or more nucleotides


ATGGCGGCGGAAAGTGGTAGCGATTTTCAGCAGAGACGTAGAAGGCGCCGGGACCCGGAGGAACCGGAAA
AAACAGAACTCAGCGAAAGAGAGCTGGCAGTAGCAGTGGCGGTGTCCCAGGAGAACGATGAGGAGAACGA
AGAGCGCTGGGTTGGACCTTTACCTGTGGAGGCAACACTGGCCAAGAAGAGGAAAGTCTTAGAGTTTGAA
AGAGTCTATCTTGATAATCTCCCCAGTGCATCCATGTATGAGCGCAGTTACATGCATAGAGATGTTATCA
CCCATGTGGTATGCACCAAAACAGATTTTATTATTACTGCCAGTCATGATGGACATGTCAAGTTCTGGAA
AAAAATAGAAGAGGGAATTGAATTTGTTAAACATTTTCGTAGTCACCTGGGAGTTATTGAGAGTATTGCA
GTTAGCTCTGAGGGAGCATTGTTCTGTTCTGTGGGTGATGATAAAGCAATGAAGGTGTTTGATGTAGTGA
ACTTTGACATGATCAACATGCTGAAACTTGGCTATTTTCCTGGACAGTGTGAGTGGATCTATTGCCCAGG
GGATGCAATTTCTTCAGTTGCTGCTTCCGAAAAGAGTACAGGAAAAATTTTCATTTATGATGGCCGAGGA
GATAACCAGCCACTTCATATTTTTGACAAACTCCATACATCACCTCTTACTCAGATACGGCTAAACCCAG
TTTACAAAGCAGTAGTGTCTTCTGACAAATCTGGGATGATTGAATACTGGACTGGGCCTCCTCATGAATA
TAAATTCCCCAAAAATGTGAACTGGGAATATAAAACTGACACTGATTTATATGAATTTGCCAAGTGTAAG
GCTTATCCAACCAGCGTATGTTTTTCACCAGATGGGAAGAAAATAGCTACTATTGGTTCTGATAGAAAAG
TTAGAATTTTCAGATTTGTAACTGGAAAACTCATGAGAGTCTTTGATGAATCACTAAGCATGTTTACTGA
ACTGCAACAGATGAGGCAACAGTTACCAGACATGGAATTTGGCCGACGAATGGCTGTAGAACGTGAGTTG
GAGAAGGTTGATGCTGTAAGATTAATTAATATAGTTTTTGATGAAACTGGACACTTCGTGCTGTATGGAA
CAATGCTGGGCATTAAAGTTATAAATGTAGAGACAAACCGGTGTGTGCGGATTTTAGGCAAACAAGAAAA
TATTAGAGTGATGCAATTGGCTTTGTTCCAGGGGATAGCCAAAAAGCATCGTGCTGCAACTACTATAGAA
ATGAAAGCTTCTGAAAATCCTGTTCTTCAGAATATTCAAGCTGACCCAACAATAGTCTGTACATCATTCA
AAAAGAATAGATTTTATATGTTTACCAAACGAGAACCAGAAGATACGAAAAGTGCAGATTCTGATCGAGA
TGTTTTTAATGAGAAACCTTCTAAAGAAGAAGTCATGGCAGCTACTCAAGCTGAAGGACCTAAACGAGTT
TCGGACAGTGCCATTATCCACACCAGCATGGGAGACATTCACACCAAACTTTTTCCTGTTGAGTGCCCTA
AGACAGTGGAAAACTTCTGTGTTCACAGCAGAAATGGTTATTATAATGGGCATACATTTCACCGTATAAT
TAAGGGCTTTATGATTCAGACTGGAGATCCAACAGGTACTGGTATGGGAGGAGAAAGCATATGGGGAGGA
GAATTTGAAGATGAATTTCATTCAACATTACGACATGACAGGCCATACACACTCAGCATGGCTAACGCGG
GATCAAATACTAATGGATCCCAGTTTTTCATAACGGTAGTACCAACGCCTTGGCTTGATAATAAGCATAC
AGTATTTGGACGAGTGACTAAAGGAATGGAAGTTGTACAGAGGATCTCCAACGTCAAAGTCAATCCCAAA
ACAGATAAGCCCTATGAGGATGTCAGCATCATAAATATTACTGTCAAGTAA


>OriGene 5' read for NM_015342 unedited
TATACGACTCACTAAGGGCGGCCGCGAACATTCGCACGAGGCGGCGGAAAGTGGTAGCGA
ATTTTCAGCAGAGACGTAGAAGGCGCCGGGACCCGGAGGAACCGGAAAAAAACGAACTCA
GCGAAGAGAGCTGGCAGTAGCAGTGGCGGTGTCCCAAGGAGAACGATGAGGAGAACGAAA
AGCGCTGGGTTGGACCTTTACCTGTGGAGGCAACACTTGGCCAAGAAGAGGAAAGTCTTA
GAGTTTGAAAGAAGTCTATCTTGATAATCTCCCCAGTGCATCCATGTATGAGCGCAGTTA
CATGCATAGAGATGTTATCACCCATGTGGTATGCACCAAAACAGATTTTATTATTACTGC
CAGTCATGATGGACATGTCAAGTTCTGGAAAAAAATAGAAGAGGGAATTGAATTTGTTAA
ACATTTTCGTAGTCACCTGGGAGTTATTGAGAGTATTGCAGTTAGCTCTGAGGGAGCATT
GTTCTGTTCTGTGGGTGATGATAAAGCAATGAAGGTGTTTGATGTAGTGAACTTTGACAT
GATCAACATGCTGAAACTTGGCTATTTTCCTGGACAGTGTGAGTGGATCTATTGCCCAGG
GGATGCAATTTCTTCAGTTGCTGCTTCCGAAAAGAGACAGGAAAAATTTTCATTTATGAT
GGCCGNAGAGATACCAGCCATTCATATTTTTGACAACTCATACATCAACCTCTACTCAGA
TAGGCTAAACCCAGTTAAAAGCAANAATTGTCTCTGACAATCTGGGATGATGATACTGGA
CTGGGCCTCTCATGATATAAATNCCAAAAATGTGAACTGGATATAAAACTGAACTGATTT
AATGAATTTGCAATGGTAGCTTATCAACAANGGTATGGTTTTACCGATGGAGAAATATTC
TCTTTTGGTTTTAAAAAAAATAAAATCTA
>OriGene 3' read for NM_015342 unedited
CCATTTTTTGAAAAATAACCTTTTAAAAAAACAAAATACTGTATCTTTGAAACATGATCT
GTATATTCAGCAAGTCCTAAGCTTCCTAATGTAAAATAATCTGTTTAATATTGTATTTTT
ATTTGCAAGTACATTAAAACAAATCTTATTTTACTTGACAGTAATATTTATGATGCTGAC
ATCCTCATAGGGCTTATCTGTTTTGGGATTGACTTTGACGTTGGAGATCCTCTGTACAAC
TTCCATTCCTTTAGTCACTCGTCCAAATACTGTATGCTTATTATCAAGCCAAGGCGTTGG
TACTACCGTTATGAAAAACTGGGATCCATTAGTATTTGATCCCGCGTTAGCCATGCTGAG
TGTGTACGGCCTGTCATGTCGTAATGTTGAATGAAATTCATCTTCAAATTCTCCTCCCCA
TATGCTTTCTCCTCCCATACCAGTACCTGTTGGATCTCCAGTCTGAATCATAAAGCCCTT
AATTATACGGTGAAATGTATGCCCATTATAATAACCATTTCTGCTGTGAACACAGAAGTT
TTCCACTGTCTTAGGGCACTCAACAGGAAAAAGTTTGGTGTGAATGTCTCCCATGCTGGT
GTGGATAATGGCACTGTCCGAAACTCGTTTAGGTCCTTCAGCTTGAGTAGCTGCCATGAC
TTCTTCTTTAGAAGGTTTCTCATTAAAAACATCTCGATCAGAATCTGCACTTTTCGTATC
TTCTGGTTCTCGTTTGGGAAACATATAAAATCTATTCTTTTTGAATGATGTACAGACTAT
TGTTGGGTCAGCTTGAATATTCTGAAGAACAAGATTTTCAGAAGCTTTCATTTCTATAGT
AGTTTGCAGCCCGATGCTTTTTGGCTATTCCCTGAAACAAACCCATTGGATCACTTTT
Restriction Sites ECoRI-NOT     
ACCN NM_015342
Insert Size 2400 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_015342.1, NP_056157.1
RefSeq Size 2110 bp
RefSeq ORF 1941 bp
Locus ID 23398
UniProt ID Q96BP3
Cytogenetics 5q12.3
Gene Summary PPIase that catalyzes the cis-trans isomerization of proline imidic peptide bonds in oligopeptides and may therefore assist protein folding (PubMed:20676357). May be involved in pre-mRNA splicing (PubMed:11991638).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) encodes the longest isoform (1).
Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.