CAMK2G (NM_172170) Human Untagged Clone

CAT#: SC100735

CAMK2G (untagged)-ORIGENE UNIQUE VARIANT 3 of Human calcium/calmodulin-dependent protein kinase II gamma (CAMK2G),

USD 299.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name CAMK2G (NM_172170) Human Untagged Clone
Symbol CAMK2G
Synonyms CAMK; CAMK-II; CAMKG
Vector pCMV6-XL4
Sequence Data
Fully Sequenced ORF
>OriGene ORF sequence for NM_172170 edited
GCCGGGCGGCGGTGACTGTGCACCGACGTCGGCGCGGGCTGCACCGCCGCGTCCGCCCGC
CCGCCAGCATGGCCACCACCGCCACCTGCACCCGTTTCACCGACGACTACCAGCTCTTCG
AGGAGCTTGGCAAGGGTGCTTTCTCTGTGGTCCGCAGGTGTGTGAAGAAAACCTCCACGC
AGGAGTACGCAGCAAAAATCATCAATACCAAGAAGTTGTCTGCCCGGGATCACCAGAAAC
TAGAACGTGAGGCTCGGATATGTCGACTTCTGAAACATCCAAACATCGTGCGCCTCCATG
ACAGTATTTCTGAAGAAGGGTTTCACTACCTCGTGTTTGACCTTGTTACCGGCGGGGAGC
TGTTTGAAGACATTGTGGCCAGAGAGTACTACAGTGAAGCAGATGCCAGCCACTGTATAC
ATCAGATTCTGGAGAGTGTTAACCACATCCACCAGCATGACATCGTCCACAGGGACCTGA
AGCCTGAGAACCTGCTGCTGGCGAGTAAATGCAAGGGTGCCGCCGTCAAGCTGGCTGATT
TTGGCCTAGCCATCGAAGTACAGGGAGAGCAGCAGGCTTGGTTTGGTTTTGCTGGCACCC
CAGGTTACTTGTCCCCTGAGGTCTTGAGGAAAGATCCCTATGGAAAACCTGTGGATATCT
GGGCCTGCGGTAAGCCCATTCCACGCTCTCAGCTTTTCGCTGTTAAGGGCCCTCAACTTC
CGATGATGGCAAGAAAGAGGCATCGCTATTCCTTGCAGTTCCCATCACCAGAATGGGACA
CGGTAACTCCTGAAGCCAAGAACTTGATCAACCAGATGCTGACCATAAACCCAGCAAAGC
GCATCACGGCTGACCAGGCTCTCAAGCACCCGTGGGTCTGTCAACGATCCACGGTGGCAT
CCATGATGCATCGTCAGGAGACTGTGGAGTGTTTGCGCAAGTTCAATGCCCGGAGAAAAC
TGAAGGGTGCCATCCTCACGACCATGCTTGTCTCCAGGAACTTCTCAGCTGCCAAAAGCC
TATTGAACAAGAAGTCGGATGGCGGTGTCAAGAAAAGGAAGTCGAGTTCCAGCGTGCACC
TAATGGAGCCACAAACCACTGTGGTACACAACGCTACAGATGGGATCAAGGGCTCCACAG
AGAGCTGCAACACCACCACAGAAGATGAGGACCTCAAAGTGCGAAAACAGGAGATCATTA
AGATTACAGAACAGCTGATTGAAGCCATCAACAATGGGGACTTTGAGGCCTACACGAAGA
TTTGTGATCCAGGCCTCACTTCCTTTGAGCCTGAGGCCCTTGGTAACCTCGTGGAGGGGA
TGGATTTCCATAAGTTTTACTTTGAGAATCTCCTGTCCAAGAACAGCAAGCCTATCCATA
CCACCATCCTAAACCCACACGTCCACGTGATTGGGGAGGACGCAGCGTGCATCGCCTACA
TCCGCCTCACCCAGTACATCGACGGGCAGGGTCGGCCTCGCACCAGCCAGTCAGAAGAGA
CCCGGGTCTGGCACCGTCGGGATGGCAAGTGGCTCAATGTCCACTATCACTGCTCAGGGG
CCCCTGCCGCACCGCTGCAGTGAGCTCAGCCACAGGGGCTTTAGGAGATTCCAGCCGGAG
GTCCAACCTTCGCAGCCAGTGGCTCTGGAGGGCCTGAGTGACAGCGGCAGTCCTGTTTGT
TTGAGGTTTAAAACAATTCAATTACAAAAGCGGCAGCAGCCAATGCACGCCCCTGCATGC
AGCCCTCCCGCCCGCCCTTCGTGTCTGTCTCTGCTGTACC
5' Read Nucleotide Sequence
>OriGene 5' read for NM_172170 unedited
NAACGCTTGGGTTTTGTAATACCACTTTTATAGGCGGCCGAAACATTCGCACGAGGGCCG
GGCGGCGGTGACTGTGCACCGACGTCGGCGCGGGCTGCACCGCCGCGTCCGCCCGCCCGC
CAGCATGGCCACCACCGCCACCTGCACCCGTTTCACCGACGACTACCAGCTCTTCGAGGA
GCTTGGCAAGGGTGCTTTCTCTGTGGTCCGCAGGTGTGTGATATAAAACCTCCACGCAGG
AGTACGCAGCAAAAATCATCAATACCAAGAAGTTGTCTGCCCGGGATCACCAGAAACTAG
AACGTGAGGCTCGGATATGTCGACTTCTGAAACATCCAAACATCGTGCGCCTCCATGACA
GTATTTCTGAAGAAGGGTTTCACTACCTCGTGTTTGACCTTGTTACCGGCGGGGAGCTGT
TTGAAGACATTGTGGCCAGAGAGTACTACAGTGAAGCAGATGCCAGCCACTGTATACATC
AGATTCTGGAGAGTGTTAACCACATCCACCAGCATGACATCGTCCACAGGGACCTGAAGC
CTGAGAACCTGCTGCTGGCGAGTAAATGCAAGGGTGCCGCCGTCAAGCTGGCTGATTTTG
GCCTAGCCATCGAAGTACAGGGAGAGCAGCAGGCTTGGTTTGGTTTTGCTGGCACCCCAG
GTTACTTGTCCCCTGAGGTCTTGAGGAAAGATCCCTATGGAAAACCTGTGGATATCTGGG
CCTGCGGTAAGCCCATTCCACGCTCTCAGCTTTTCGCTGTTAAGGGCCCTCAACTTCCGA
TGATGGNNCAGAAAGAGCATCGCTATTCCCTTGCAGTTCCCATCACCAGAATGGGACACG
GGTAACTCTGAAAGCAAGAACTTGATCAACCAGATGCTGACCATNAACCAGCAAGCGCTC
ACGGCTGACAAGCTCTCAACCACCG
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_172170
ORF Size 1557 bp
OTI Disclaimer The sequence of an 'OriGene Unique Variant' differs significantly from the associated reference. It represents a novel splice variant from the same gene locus of the reference. Although such variants are true transcripts and present opportunity for discoveries, they are not yet curated by NCBI and should not be used if the exact reference accession sequence is required.
OTI Annotation This TrueClone was found to represent an alternative form of the specific reference to which it is associated. Its Open Reading Frame (ORF) may represent a novel form or alternative splice variant. By virtue of it being a true transcript (cDNA clone not PCR product), it provides a biologically relevant copy of its mRNA template. For more details, please evaluate the sequence information provided on this website or contact our customer care specialists.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_172170.2, NP_751910
RefSeq Size 3712
Locus ID 818
Cytogenetics 10q22.2
Protein Families Protein Kinase, Druggable Genome
Protein Pathways ErbB signaling pathway, Calcium signaling pathway, Oocyte meiosis, Wnt signaling pathway, Long-term potentiation, Neurotrophin signaling pathway, Olfactory transduction, GnRH signaling pathway, Melanogenesis, Glioma
Gene Summary The product of this gene is one of the four subunits of an enzyme which belongs to the serine/threonine protein kinase family, and to the Ca(2+)/calmodulin-dependent protein kinase subfamily. Calcium signaling is crucial for several aspects of plasticity at glutamatergic synapses. In mammalian cells the enzyme is composed of four different chains: alpha, beta, gamma, and delta. The product of this gene is a gamma chain. Many alternatively spliced transcripts encoding different isoforms have been described but the full-length nature of all the variants has not been determined.[provided by RefSeq, Mar 2011].
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.