Sigma1 receptor(SIGMAR1) (NM_147157) Human Untagged Clone

CAT#: SC100278

SIGMAR1 (untagged)-Human sigma non-opioid intracellular receptor 1 (SIGMAR1), transcript variant 2

USD 402.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Sigma1 receptor(SIGMAR1) (NM_147157) Human Untagged Clone
Symbol SIGMAR1
Synonyms ALS16; DSMA2; hSigmaR1; OPRS1; SIG-1R; sigma1R; SR-BP; SR-BP1; SRBP
Vector pCMV6-XL6
Sequence Data
Fully Sequenced ORF
>OriGene ORF sequence for NM_147157 edited
ATGCAGTGGGCCGTGGGCCGGCGGTGGGCGTGGGCCGCGCTGCTCCTGGCTGTCGCAGCG
GTGCTGACCCAGGTCGTCTGGCTCTGGCTGGGTACGCAGAGCTTCGTCTTCCAGCGCGAA
GAGATAGCGCAGTTGGCGCGGCAGTACGCTGGGCTGGACCACGAGCTGGCCTTCTCTCGT
CTGATCGTGGAGCTGCGGCGGCTGCACCCAGGCCACGTGCTGCCCGACGAGGAGCTGCAG
TGGGTGTTCGTGAATGCGGGTGGCTGGATGGGCGCCATGTGCCTTCTGCACGCCTCGCTG
TCCGAGTATGTGCTGCTCTTCGGCACCGCCTTGGGCTCCCGCGGCCACTCGGGGGAGACG
GTAGTACACGGGCCTGGTGAGGCAACAGCTGTGGAGTGGGGGCCAAACACATGGATGGTG
GAGTACGGCCGGGGCGTCATCCCATCCACCCTGGCCTTCGCGCTGGCCGACACTGTCTTC
AGCACCCAGGACTTCCTCACCCTCTTCTATACTCTTCGCTCCTATGCTCGGGGCCTCCGG
CTTGAGCTCACCACCTACCTCTTTGGCCAGGACCCTTGA
Tag Tag Free
ACCN NM_147157
ORF Size 579 bp
Insert Size 1900
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_147157.1.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_147157.1, NP_671513
RefSeq Size 1580
Locus ID 10280
Cytogenetics 9p13.3
Domains ERG2_Sigma1R
Protein Families GPCR, Transmembrane, Druggable Genome
Gene Summary This gene encodes a receptor protein that interacts with a variety of psychotomimetic drugs, including cocaine and amphetamines. The receptor is believed to play an important role in the cellular functions of various tissues associated with the endocrine, immune, and nervous systems. As indicated by its previous name, opioid receptor sigma 1 (OPRS1), the product of this gene was erroneously thought to function as an opioid receptor; it is now thought to be a non-opioid receptor. Mutations in this gene has been associated with juvenile amyotrophic lateral sclerosis 16. Alternative splicing of this gene results in transcript variants encoding distinct isoforms. [provided by RefSeq, Aug 2013].
Transcript Variant: This variant (2) lacks an in-frame exon in the central coding region, compared to variant 1. The encoded isoform (2) is shorter, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.