Pyruvate Dehydrogenase E2(DLAT) (NM_001931) Human Untagged Clone

CAT#: SC100111

DLAT (untagged)-Human dihydrolipoamide S-acetyltransferase (DLAT), nuclear gene encoding mitochondrial protein

USD 721


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Pyruvate Dehydrogenase E2(DLAT) (NM_001931) Human Untagged Clone
Symbol DLAT
Synonyms DLTA; PDC-E2; PDCE2
Vector pCMV6-XL4
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC100111 sequence for NM_001931 edited (data generated by NextGen Sequencing)
ATGTGGCGCGTCTGTGCGCGACGGGCTCAGAATGTAGCCCCATGGGCGGGACTCGAGGCT
CGGTGGACGGCCTTGCAGGAGGTACCCGGAACTCCACGAGTGACCTCGCGATCTGGCCCG
GCTCCCGTTCGTCGCAACAGCGTGACTACAGGGTATGGCGGGGTCCGGGCACTGTGCGGC
TGGACCCCCAGTTCTGGGGCCACGCCGCGGAACCGCTTACTGCTGCAGCTTTTGGGGTCG
CCCGGCCGCCGCTATTACAGTCTTCCCCCGCATCAGAAGGTTCCATTGCCTTCTCTTTCC
CCCACAATGCAGGCAGGCACCATAGCCCGTTGGGAAAAAAAAGAGGGGGACAAAATCAAT
GAAGGTGACCTAATTGCAGAGGTTGAAACTGATAAAGCCACTGTTGGATTTGAGAGCCTG
GAGGAGTGTTATATGGCAAAGATACTTGTTGCTGAAGGTACCAGGGATGTTCCCATCGGA
GCGATCATCTGTATCACAGTTGGCAAGCCTGAGGATATTGAGGCCTTTAAAAATTATACA
CTGGATTCCTCAGCAGCACCTACCCCACAAGCGGCCCCAGCACCAACCCCTGCTGCCACT
GCTTCGCCACCTACACCTTCTGCTCAGGCTCCTGGTAGCTCATATCCCCCTCACATGCAG
GTACTTCTTCCTGCCCTCTCTCCCACCATGACCATGGGCACAGTTCAGAGATGGGAAAAA
AAAGTGGGTGAGAAGCTAAGTGAAGGAGACTTACTGGCAGAGATAGAAACTGACAAAGCC
ACTATAGGTTTTGAAGTACAGGAAGAAGGTTATCTGGCAAAAATCCTGGTCCCTGAAGGC
ACAAGAGATGTCCCTCTAGGAACCCCACTCTGTATCATTGTAGAAAAAGAGGCAGATATA
TCAGCATTTGCTGACTATAGGCCAACCGAAGTAACAGATTTAAAACCACAAGCGCCACCA
CCTACCCCACCCCCGGTGGCCGCTGTTCCTCCAACTCCCCAGCCTTTAGCTCCTACACCT
TCAGCACCCTGCCCAGCTACTCCTGCTGGACCAAAGGGAAGGGTGTTTGTTAGCCCTCTT
GCAAAGAAGTTGGCAGTAGAGAAAGGGATTGATCTTACACAAGTAAAAGGGACAGGACCA
GATGGTAGAATCACCAAGAAGGATATCGACTCTTTTGTGCCTAGTAAAGTTGCTCCTGCT
CCGGCAGCTGTTGTGCCTCCCACAGGTCCTGGAATGGCACCAGTTCCTACAGGTGTCTTC
ACAGATATCCCAATCAGCAACATTCGTCGGGTTATTGCACAGCGATTAATGCAATCAAAG
CAAACCATACCTCATTATTACCTTTCTATCAATGTAAATATGGGAGAAGTTTTGTTGGTA
CGGAAAGAACTTAATAAGATATTAGAAGGGAGAAGCAAAATTTCTGTCAATGACTTCATC
ATAAAAGCTTCAGCTTTGGCATGTTTAAAAGTTCCCGAAGCAAATTCTTCTTGGATGGAC
ACAGTTATAAGACAAAATCATGTTGTTGATGTCAGTGTTGCGGTCAGTACTCCTGCAGGA
CTCATCACACCTATTGTGTTTAATGCACATATAAAAGGAGTGGAAACCATTGCTAATGAT
GTTGTTTCTTTAGCAACCAAAGCAAGAGAGGGTAAACTACAGCCACATGAATTCCAGGGT
GGCACTTTTACGATCTCCAATTTAGGAATGTTTGGAATTAAGAATTTCTCTGCTATTATT
AACCCACCTCAAGCATGTATTTTGGCAATTGGTGCTTCAGAGGATAAACTGGTCCCTGCA
GATAATGAAAAAGGGTTTGATGTGGCTAGCATGATGTCTGTTACACTCAGTTGTGATCAC
CGGGTGGTGGATGGAGCAGTTGGAGCCCAGTGGCTTGCTGAGTTTAGAAAGTACCTTGAA
AAACCTATCACTATGTTGTTGTAA

Clone variation with respect to NM_001931.4
128 c=>t;953 t=>c;1351 g=>a
5' Read Nucleotide Sequence
>OriGene 5' read for NM_001931 unedited
NGGGTTTCGATTTGTATCCGATTTCCTATAGGCGGCCGCGCATTCGGCACGAGATTTCTC
CCAAACTTGCGCCCGCACAGGCCCCTCTGGAACACTCCTGCCCCGTAGTGCCCCTCGTCC
CCGCTCCGTAGAGAAAGAGCGTGCGTGCCGCGCATTTCTGGCCTGGGGAGCGGGTGGAGT
AAACCTGCGGGAACCATTTTACGACAACGTGCGGCTGTGCGGTGTGGCTGACGGCAACGC
CGCTGCTCTTGGAGAGGTCACTCCGGAGACGGCGTTGGTTTTGGGGTGTGGGGGGTTGGT
GGCACTATGTGGCGCGTCTGTGCGCGACGGGCTCAGAATGTAGCCCCATGGGCGGGACTC
GAGGCTCGGTGGACGGCCTTGCAGGAGGTACCCGGAACTCCACGAGTGACCTCGCGATCT
GGCCCGGCTCCCGTTCGTCGCAACAGCGTGACTACAGGGTATGGCGGGGTCCGGGCACTG
TGCGGCTGGACCCCCAGTTCTGGGGCCACGCCGCGGAACCGCTTACTGCTGCAGCTTTTG
GGGTCGCCCGGCCGCCGCTATTACAGTCTTCCCCCGCATCAGAAAGTTCCATTGCCCTCT
CTTTCCCCCACATGCAGGCAGGCACCATAGCCCGTTGGGAAAAAAAAAGAGGGGGACAAA
ATCAATGAAGTGACCCTATTTGCAGAGTTTGAACTGATAAAGCCACTGTTGGATTTGAGA
GCCTGGNAGGAGTGTATATGGCAAAGATACTTGTTGGCTGAAGTACCAGGGATGTTCCCC
TTCGGACGATCATCTGTTTCAACAGTGGGAAGCCCTGAAGATATTGAGGCTTTTAAAATT
TTACATGGGATTCCTAAGAAGCACCTACCCAAAAGGGGGCCCGGACCAAACCTTGT
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_001931
ORF Size 1944 bp
Insert Size 4700
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001931.2, NP_001922
RefSeq Size 3321
RefSeq ORF 1944
Locus ID 1737
Cytogenetics 11q23.1
Domains biotin_lipoyl, 2-oxoacid_dh, e3_binding
Protein Families Druggable Genome
Protein Pathways Glycolysis / Gluconeogenesis, Citrate cycle (TCA cycle), Pyruvate metabolism, Metabolic pathways
Gene Summary This gene encodes component E2 of the multi-enzyme pyruvate dehydrogenase complex (PDC). PDC resides in the inner mitochondrial membrane and catalyzes the conversion of pyruvate to acetyl coenzyme A. The protein product of this gene, dihydrolipoamide acetyltransferase, accepts acetyl groups formed by the oxidative decarboxylation of pyruvate and transfers them to coenzyme A. Dihydrolipoamide acetyltransferase is the antigen for antimitochondrial antibodies. These autoantibodies are present in nearly 95% of patients with the autoimmune liver disease primary biliary cirrhosis (PBC). In PBC, activated T lymphocytes attack and destroy epithelial cells in the bile duct where this protein is abnormally distributed and overexpressed. PBC enventually leads to cirrhosis and liver failure. Mutations in this gene are also a cause of pyruvate dehydrogenase E2 deficiency which causes primary lactic acidosis in infancy and early childhood.[provided by RefSeq, Oct 2009].
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.