(NM_001109899) Rat Untagged Clone

CAT#: RN215714

Oaz2 (untagged) - Rat ornithine decarboxylase antizyme 2 (Oaz2), transcript variant 1

USD 196.00


Availability*
2 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name (NM_001109899) Rat Untagged Clone
Synonyms RGD1562933
Vector pCMV6-Entry
Sequence Data
Fully Sequenced ORF
>RN215714 representing NM_001109899
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGATAAACACCCAGGACAGTAGTATTTTGCCTTTGAGTAACTGTCCCCAGCTCCAGTGCTGCAGGCACA
TTGTTCCAGGGCCTCTGTGGTGCTCCATGATAAACACCCAGGACAGTAGTATTTTGCCTTTGAGTAACTG
TCCCCAGCTCCAGTGCTGCAGGCACATTGTTCCAGGGCCTCTGTGGTGCTCC


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_001109899
ORF Size 192 bp
Insert Size 192
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This clone expresses the complete ORF with c-terminal tags of Myc-DDK
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001109899.2,
RefSeq Size 1828
RefSeq ORF 192
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.